Labshake search
Citations for New England Biolabs :
1 - 50 of 8756 citations for Rat Fibroblast Growth Factor 21 FGF21 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... coli BL-21 (DE3) (New England Biolabs) cells and 5mL starter cultures were grown overnight at 37C in Lysogeny Broth (LB ...
-
bioRxiv - Biochemistry 2024Quote: ... coli BL-21 cells (New England Biolabs) were used for the transformation of pET-28b(+ ...
-
bioRxiv - Microbiology 2021Quote: ... streptavidin magnetic beads (21 μL per reaction; NEB) were washed once in an equal volume of 1X SSC and then resuspended in 7.5 μL per reaction 1X SSC with 1 μL per reaction of Superase-In (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... coli C2527 (BL-21) (New England Biolabs, Inc) for purification ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µL factor mix (NEB), 250 nM pre-incubated 50S ribosomal subunits ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL factor mix (NEB), 250 nM pre-incubated 50S ribosomal subunits ...
-
bioRxiv - Microbiology 2023Quote: ... which was subsequently cloned into linearized pUHE-21 (106) using NEBuilder HiFi DNA Assembly Cloning Kit (New England BioLabs). Construct was verified by Sanger DNA sequencing with primers 146 and 156.
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Microbiology 2019Quote: ... Growth was monitored every 2 min using a Cell Growth Quantifier (Aquila Biolabs).
-
bioRxiv - Biophysics 2020Quote: ... Factor Xa protease (New England Biolabs) was added to the MT solution at a molar ratio of 1 ...
-
bioRxiv - Plant Biology 2021Quote: ... Factor Xa (P8010S, New England BioLabs) or TEV protease (P8112S ...
-
bioRxiv - Biochemistry 2023Quote: ... 20 µg factor Xa protease (NEB) and 5 mM CaCl2 with inversion at 10 °C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... a 21 kb genomic DNA fragment of bacteriophage lambda (NEB) was flanked by a unique XbaI (position 0 ...
-
bioRxiv - Systems Biology 2019Quote: ... The growth was continuously monitored online using Cell Growth Quantifier (CGQ) (Aquila Biolabs GmBH), and the samples were withdrawn at the start of the experiment ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Neuroscience 2020Quote: ... with PAM underlined: GCAACTGGTACAGATGACACAGG) targeting exon 21 of the Brp gene was generated using the HiScribe T7 Kit (New England Biolabs #E2040S) by incubating for 6 hours at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: cDNA of each library was generated using oAS345 (Supplemtary Note 21) and LunaScript Primer-Free RT Master Mix Kit (NEB E3025S).
-
bioRxiv - Systems Biology 2019Quote: ... 30°C and the growth was continuously monitored online using Cell Growth Quantifier (Aquila Biolabs GmBH). Samples were withdrawn at regular intervals for analyzing the spent metabolites through High-Performance Liquid Chromatography (HPLC).
-
bioRxiv - Cell Biology 2021Quote: All dox-inducible factors were generated by cloning the open reading frame of each factor into the pMINI vector (NEB) and then restricted with EcoRI or MfeI and inserted into the FUW-TetO expression vector ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Biochemistry 2022Quote: In vitro protein translation was carried out (in absence of the release factors) using the PURExpress ΔRF123 kit (New England Biolabs). This guaranteed the stabilization of the ternary complexes mRNA-affitin-Ribosome ...
-
bioRxiv - Evolutionary Biology 2021Quote: Mutagenesis of the binding sites for the predicted Caudal and DEAF-1 transcription factors was performed sequentially with the Q5 Site-Directed Mutagenesis kit (New England Biolabs) taking as a template the pGreenRabbit vector containing the FBti0019386 sequence following manufacturer’s instructions (25) ...
-
bioRxiv - Microbiology 2022Quote: ... Clean RNA was first rRNA depleted using the NEBNext rRNA depletion kit (Human/Mouse/Rat) (NEB) before being prepared for sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) according to the manufacturer’s instructions with 6 µl total RNA used as input per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... Mutations were generated in the rat P2X2 receptor using the Q5 Site-Directed Mutagenesis Kit (NEB). Each mutation was verified by DNA sequencing and subcloned in pWPT-EF1α-P2X2-GCaMP6s-IRES-DsRed2 or pWPT-EF1α-P2X2-GCaMP6s-P2A-mScarlet lentiviral vectors.
-
bioRxiv - Cancer Biology 2023Quote: ... library was prepared using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). The RNA-Seq libraries were sequenced on NextSeq 500 using the NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... and rat (New England Biolabs), following the manufactures instructions.
-
bioRxiv - Biophysics 2021Quote: MukF Flag-tagged fragments were expressed from pET 21 plasmids in C3013I cells (NEB).The Flag-tagged MukE and MuF were at the C-terminus ...
-
bioRxiv - Molecular Biology 2022Quote: ... We then carried out rRNA depletion with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat NEB # E6310S) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and libraries were prepared using the NEBNext rRNA Depletion Kit for Human/Mouse/Rat (NEB Cat#E6310). Adapter-ligated cDNA was amplified with 11 cycles of PCR to generate libraries ∼300 bp in length ...
-
bioRxiv - Microbiology 2020Quote: ... the resin was treated with factor Xa protease (P8010L, NEB) overnight at 4°C ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... the MPB tag was cleaved overnight using Factor Xa (NEB) in dialysis buffer and loaded again on an MBP-Trap HP column ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μL of factor mix (with RNA polymerase, and transcription/translation factors in 10 mM Mg2+) from the PURExpress® Δ Ribosome Kit (New England Biolabs). The reaction buffer was based on Shimizu et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and rat (New England Biolabs, USA) that specifically depletes cytoplasmic (5S ...
-
bioRxiv - Molecular Biology 2023Quote: ... and amplified by lytic growth in LE392 cells (NEB). Following lytic growth ...
-
bioRxiv - Biochemistry 2021Quote: ... MBP was cleaved from LH using Factor Xa (New England Biolabs) at a w/w ratio of 1% Factor Xa:LH ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...