Labshake search
Citations for New England Biolabs :
101 - 150 of 9774 citations for Rat 3 Hydroxy 3 Methylglutaryl CoA Reductase HMGCR ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... 3’-biotinylated λ-DNA (NEB, Ipswich, MA) was attached to the pre-added lipid bilayer surface (DOPC ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2022Quote: ... adenosine addition at 3’ end (NEB, M0212), ligation of Illumina indexed adapters (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 units of T4 DNA polymerase (NEB), 9 units of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μl of BSA (New England BioLabs), sterile MilliQ water up to 50 μl and 10 ng of DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Immunology 2022Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genetics 2022Quote: ... with Klenow fragment (3’-5’ exo-; NEB). Hybridization signals were obtained using Typhoon FLA 7000 (GE Healthcare ...
-
bioRxiv - Physiology 2022Quote: ... 3 μl USER Enzyme (New England BioLabs) was then used with size-selected ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 units of USER enzyme (NEB, Cat.No.M5505) and 40units of recombinant rnase inhibitor was added into elution products and incubated at 37°C for 20min for DNA strand digestion ...
-
bioRxiv - Developmental Biology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Zoology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Plant Biology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μL CutSmart buffer (New England Biolabs), 20 μL DNA solution (50 ng total DNA ...
-
bioRxiv - Developmental Biology 2019Quote: ... 7.5U Klenow 3’-5’ exo minus (NEB) were incubated for 30 min at 37°C ...
-
bioRxiv - Pathology 2021Quote: ... 3 µL of DNAse I (NEB, USA) were added ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 μl ThermoPol Buffer (New England Biolabs), 1 μl dNTPs (10 mM) ...
-
bioRxiv - Microbiology 2020Quote: ... consisting of 3 μL DNase I (NEB), 3 μL 10xDNase I Buffer (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Pathology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... 3 µl of Lambda Exonuclease (NEB, #M0262L), and 3 µl of Exonuclease I (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of PvuI (NEB, Cat. R3150S) PacI (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μg of total RNA was reverse transcribed using LunaScript cDNA Synthesis Kit (New England Biolabs). Gene-expression levels were quantified by real-time quantitative PCR (iCycler iQ BioRad ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Immunology 2022Quote: ... and we digested up to 3 μg of DNA with 3 μl of EcoRI-HF restriction enzyme (New England Biolabs) per 50 μl.
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification of the target locus (forward primer: 5’-GGTTCTCAGTGCACGCATTT-3’; reverse primer: 5’-ACAACGATTTTCCTGGCATCT-3’) with Q5 polymerase (NEB), and Sanger sequencing of PCR products by the Keck Biotechnology Resource Laboratory at Yale ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends of fragments using Klenow fragment (3’ to 5’ exo minus, New England Biolabs), universal adaptors were ligated to the A-tailed DNA fragments at room temperature for 1 h with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... fragmented nascent RNA was dissolved in H2O and incubated with 10 pmol of reverse 3’ RNA adaptor (5’p-rNrNrNrNrNrNrGrArUrCrGrUrCrGrGrArCrUrGrUrArGrArArCrUrCrUrGrArArC-/3’InvdT/) and T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...