Labshake search
Citations for New England Biolabs :
401 - 450 of 466 citations for Rabbit Anti Human IgM Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... MBP-tagged and GST-tagged proteins were detected using anti-MBP (E8032S, NEB) and anti-GST antibody (60-021 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Anti-sense probe templates were either linearized with Sac2 (New England BioLabs #R0157S) and synthesized with SP6 RNA polymerase (Promega #P108G ...
-
bioRxiv - Neuroscience 2021Quote: ... with 3’-O-Me-m7GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at 8:1 to GTP for a capping efficiency of ∼90% ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by detection of ubiquitinated substrate by immunoblotting using anti-MBP (New England Biolabs), anti-GST and anti-ubiquitin (Santa Cruz Biotechnology ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were then incubated for 1 hour with anti-MBP antibody (New England BioLabs) solution diluted in calcium containing blocking buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... Fgfrb-eGFP signal was detected using an anti-GFP antibody (TP401, Torrey Pine Biolabs) in combination with nuclear (Hoechst ...
-
bioRxiv - Molecular Biology 2021Quote: ... a set of 5’-end biotinylated anti-sense DNA oligoes and 5ul RNase inhibitor (NEB) were added to the lysate ...
-
bioRxiv - Microbiology 2021Quote: ... The assay mixture was then analyzed using western blotting by anti-MBP (New England Biolabs) and anti-His (D2951 ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-Flag immobilized Mif2-6xHis-6xFlag was then treated with lambda-phosphatase (New England Biolabs) according to the manufacturer’s instruction and incubated for 2 h at 30 °C and 1200 rpm in a thermomixer ...
-
bioRxiv - Biochemistry 2019Quote: ... and lysine crotonylation was detected using a pan-specific anti-CrK antibody (PTM Biolabs, PTM105), both were used according to manufacturer’s specifications.
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was then probed with the primary anti-MBP antibody (NEB E8032S, 1:10000) diluted in 5% NFDM (overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... The anti-Flag immunoprecipitates were subject to Lambda phosphatase treatment (NEB #P0753L, Ipswich, MA, USA).
-
bioRxiv - Plant Biology 2023Quote: ... followed by detection of the ubiquitinated substrate by immunoblotting using anti-MBP (New England Biolabs), anti-GST and anti-ubiquitin (Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2021Quote: ... pH 8.0) were incubated with pre-washed pan anti-Kbhb beads (PTM Biolabs Inc., Chicago, IL) at 4 °C overnight with gentle shaking ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment(anti-sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sense and anti-sense digoxigenin labeled probes were then produced using Taq polymerase (New England Biolabs) and 40 cycles of PCR with either the sense or anti-sense primer in a Taq polymerase PCR mixture to which 0.067 mM of Digoxigenin-5-aminoallyl-dUTP (Jena Bioscience GmbH ...
-
bioRxiv - Plant Biology 2020Quote: ... The elutes were separated by 12% SDS-PAGE and subjected to immunoblotting using anti-MBP (NEB) and anti-His (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... The assay mixture was then analyzed using western blotting by anti-PanKcr (PTM-501, PTM Biolabs) and anti-H3 (ab1791 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercial antibodies used in this study are Pan anti-butyryllysine (PTM Biolabs, SKU: PTM 301), Butyryl-Histone H4 (Lys 12 ...
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: Lysine-succinylated peptides were enriched using agarose-conjugated pan anti-succinyllysine antibody (PTM Biolabs, Hangzhou, China). In brief ...
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: ... pH 8.0) were incubated with pre-washed pan anti-succinyllysine (PTM-104, PTM Biolabs, Hangzhou, China) conjugated agarose beads at 4°C overnight with gentle oscillation ...
-
bioRxiv - Physiology 2022Quote: ... sense and anti-sense oligo DNAs (IDT) (Table S1) were phosphorylation using T4 Polynucleotide Kinase (NEB) at 37 °C for 30 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used for immunoblots in this study were anti-tau (tau46) (1:5000; NEB 4019S), anti-human tau (tau13 ...
-
bioRxiv - Cell Biology 2019Quote: ... then incubated with either mouse anti-MBP antibodies at a dilution of 1:5000 (New England Biolabs) or 1:2500 mouse anti-GFP antibodies (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were separated by SDS-PAGE and detected by immunoblotting using anti-MBP (New England BioLabs, E8032S), anti-GST (MBL ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound protein was detected by western blot using mouse anti-MBP diluted 1:10,000 (New England Biolabs), fluorescent secondary antibodies (Li-Cor Biosciences) ...
-
bioRxiv - Systems Biology 2023Quote: ... and the sense and anti-sense crRNA oligos were annealed and phosphorylated with T4 PNK (NEB, M0201). The linearized pRG212 vector and crRNA oligo were then ligated with T4 DNA Ligase (M0202).
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL phosphorylation mix (1µL 100mM sense oligo, 1µL 100mM anti-sense oligo, 0.5µL 25mM ATP (BioLabs #P0756S), 1µL 10X PNK T4 Buffer (BioLabs #B0201S) ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... was detected by addition of 1 nM Europium-labeled anti-p53 phosphoserine 15 antibody (New England Biolabs/ Cisbio) and 40 nM streptavidin-conjugated APC (Prozyme ...
-
bioRxiv - Plant Biology 2022Quote: ... and the ubiquitinated ERECTA_CD were detected by IB analysis with anti-MBP (E8032, 1:10,000, New England Biolabs) as primary antibody ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment (sense/anti-sense) Pceh-23_L::acy-2 fragment(sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2019Quote: ... the purified C-I30-Flag protein (30µl beads) was digested on beads (Anti-FLAG M2 affinity gel) with final 5U Enterokinase (cat#: P8070S, NEB) in the 1x EK reaction buffer (20 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... the purified C-I30-Flag protein (30µl beads) was digested on beads (Anti-FLAG M2 affinity gel) with final 10U CIP Phosphatase (cat#: M0290S, NEB) in the 1x CIP buffer (50 mM Potassium Acetate ...
-
bioRxiv - Developmental Biology 2021Quote: ... Positive clones were digested with the appropriate enzyme to linearize the plasmid and anti-sense ribonucleoprobe synthesis was carried out using Sp6 or T7 RNA polymerase (New England Biolabs)+DIG labeled UTP (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... glabrata total cell lysates using the anti-Rad53 antibodies described in the previous section and Protein A magnetic beads (New England Biolabs). The immunoprecipitated samples were run on 8% acrylamide gels ...
-
bioRxiv - Microbiology 2021Quote: ... and either stored at −20°C or 10 μg used for immunoblots with an Anti-IkBa antibody (New England Biolabs) (54).
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Biochemistry 2019Quote: ... Proteins were separated through SDS-PAGE and transferred to PVDF membrane followed by incubation with anti-MBP monoclonal antibody (E8032S, NEB) and M2 Flag antibody (A8592 ...
-
bioRxiv - Immunology 2021Quote: The cDNA sequences of the paired variable heavy and light chain region of anti-RBD antibody clones were synthesized as gBlocks (IDT) and cloned by the Gibson assembly (NEB) into human IgG1 heavy chain and light chain expression plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragmented RNA was mixed with Protein G Magnetic bead prebound monoclonal anti-m6A antibody (1 µL) from the EpiMark N6-Methyladenosine Enrichment Kit (New England Biolabs), resuspended in 300 µl EpiMark IP buffer supplemented with murine RNase inhibitor (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA used in this study was capped with either m7G (Anti-Reverse Cap Analog [ARCA], S1411L) or ApppG cap analog (S1406S, New England Biolabs).
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated through SDS-PAGE and transferred to a PVDF membrane followed by incubation with anti-MBP monoclonal antibody (E8032S, NEB) and M2 Flag antibody (A8592 ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7). In brief ...