Labshake search
Citations for New England Biolabs :
1 - 50 of 8870 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... we used a colorimetric assay using p-Nitrophenyl phosphate (pNPP) (NEB) as a substrate ...
-
bioRxiv - Immunology 2019Quote: ... The culture supernatant was projected to perform luciferase assay with Gaussia Luciferase assay kit and Cypridina Luciferase assay kit (NEB) following their description.
-
bioRxiv - Cell Biology 2023Quote: ... The Oxiselect Comet Assay Kit (Cell-Biolabs) was used as a reference for the experiment ...
-
bioRxiv - Microbiology 2020Quote: ... the BioLux® Gaussia Luciferase Assay Kit (NEB, discontinued) or the GAR-2B Gaussia Luciferase Assay (Targeting Systems ...
-
bioRxiv - Cell Biology 2021Quote: 500mM p-Nitrophenyl Phosphate (pNPP, NEB, P0757S) substrate solution was diluted to 20 mM in phosphatase reaction buffer (PRB ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Cypridina Luciferase Assay Kit (New England Biolabs) and Gaussia luciferase was assayed from 1:40 diluted cell culture supernatant using either the Stop & Glo reagent from the DualLuciferase® Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... or BioLux® Gaussia Luciferase Assay Kit (New England Biolabs) in a Lumat LB 9507 luminometer (Berthold Technologies).
-
bioRxiv - Microbiology 2021Quote: ... or a Biolux Gaussia luciferase assay kit (New England BioLabs) and a GloMax microplate reader (Promega) ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Microbiology 2019Quote: ... Assays were performed using NEB BioLux Gaussia Luciferase (GLuc) kit (NEB #E3300L) following the stabilized protocol ...
-
bioRxiv - Microbiology 2024Quote: In vitro transcription/translation assays were conducted using the PURExpress kit (NEB) according to the manufacturer’s protocol with a 2-hour incubation at 37 °C ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-phosphate was added via T4 polynucleotide kinase (NEB) at 37 ºC for 30 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: Coupled transcription-translation assays were carried out with the PURExpress kit (New England BioLabs) as described in (Lukasiewicz and Contreras ...
-
bioRxiv - Biochemistry 2023Quote: ... Assays were set-up using PURExpress in vitro protein synthesis kit (New England Biolabs) with a cloned full-length DHFR template ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was purified by silica-based SPE using Monarch RNA Cleanup Kits (for in vitro assays) or Total RNA Miniprep Kit for intracellular samples (NEB).
-
bioRxiv - Cancer Biology 2024Quote: ... and treated with 800 U of Lambda Phosphates (New England Biolabs) for 30 min at 30°C ...
-
bioRxiv - Immunology 2021Quote: We quantified plasma luciferase activity by a BioLux Gaussia Luciferase Assay Kit (NEB, Ipswich, MA) from 10 μL plasma acquired by retro-orbital bleeding ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the High Sensitivity DNA Assay and NEBNext Library Quant Kit for Illumina (NEB, E7630). Finally ...
-
bioRxiv - Synthetic Biology 2020Quote: ... GLuc activity in samples was measured using the Biolux Gaussia Luciferase Assay kit (NEB, Ipswich, MA). GLuc assay solution (50 μL ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2.5mM Na2P2H2O7 and 20mM β-glycerol phosphate) and 10mM ATP (New England Biolabs) to a total volume of 50µl ...
-
bioRxiv - Plant Biology 2022Quote: ... and 6 µM p-Nitrophenyl Phosphate (pNPP) (New England Biolabs Catalog Number P0757S) at 25°C at a pH of 5.0 ...
-
bioRxiv - Neuroscience 2019Quote: ... and 24 hours of incubation GLuc activity was quantified using the BioLux Gaussia Luciferase Assay Kit (NEB) according to the manufacturer’s instructions with luminescent detection on a SpectraMax M5 Microplate Reader (Molecular Devices ...
-
bioRxiv - Cell Biology 2020Quote: ... These peptides were used as the substrate in a PKA kinase assay kit (New England Biolabs, #P6000S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... These peptides were used as the substrate in a PKA kinase assay kit (New England Biolabs, #P6000S) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... The assay was performed using the PURExpress In Vitro Protein Synthesis Kit (E6800S New England Biolabs, Inc.), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB) with the CDC-derived primers for N1 and N2 gene targets and the reaction was performed using the QuantStudio™ 5 System (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Molecular Biology 2019Quote: Purified RNAs were treated with alkaline phosphatase (Calf Intestinal Phosphate from New England Biolabs) at 50°C for 15min followed by heat inactivation at 95°C for 2.5min ...
-
bioRxiv - Cell Biology 2019Quote: ... immunoprecipitated beads were incubated with 40 Units of lambda protein phosphate (New England Biolabs) in a 50 μl reaction ...
-
bioRxiv - Microbiology 2021Quote: ... After incubation with 5‘-phosphate-dependent exoribonuclease XRN-1 (New England BioLabs, Inc., USA), samples were treated with RNA 5‘ polyphosphatase (Lucigen) ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoprecipitated beads were incubated with 40 Units of lambda protein phosphate (New England Biolabs) in a 50 μl reaction ...
-
bioRxiv - Microbiology 2019Quote: ... then 100 μL of 4 mg/mL p-nitrophenyl phosphate (New England Biolabs, MA, USA) was added and the mixture was vortexed again ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 4 (supplied by NEB, 500 mM Sodium Phosphate, pH 4.5), and 1 μL of α1-2,3,6 Mannosidase.
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 2 (supplied by NEB, 500 mM Sodium Phosphate, pH 7.5), and 1 μL of PNGase ...
-
bioRxiv - Biochemistry 2020Quote: ... The 5’ phosphate of transcribed RNA ligands was removed using calf intestinal phosphatase (CIP, NEB) and then replaced with 32P using T4 polynucleotide kinase (PNK ...
-
bioRxiv - Microbiology 2020Quote: ... 30 mM acetyl phosphate or 1 µl Calf Intestinal Alkaline Phosphatase (CIP) (NEB, catalog#: M0290V) was added to the solution ...
-
bioRxiv - Microbiology 2022Quote: ... while Gluc and Cluc expression levels were determined using Biolux Gaussia or Cypridina luciferase assay kits (New England BioLabs) and a microplate reader ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 pmol of TP_MAAAPQKCAAA* mRNA (see “Toeprinting assays” section) and components of the PURExpress ΔRibosomes Kit (New England Biolabs). The reaction was incubated at 37ºC for 20 min and then diluted in 50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Genetics 2019Quote: ... and phosphate groups added to the 5’ends using T4 Polynucleotide Kinase (New England Biolabs, M0201S) by first incubating for 30 minutes without ATP and then 30 min with ATP to remove and add the phosphate group ...
-
bioRxiv - Microbiology 2020Quote: ... either 30 mM acetyl phosphate or 0.5 μl Calf Intestinal Alkaline Phosphatase (CIP) (NEB, catalog#: M0290V) was added to the solution ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Dephosphorylation of cyclic phosphate groups were carried out with T4 PNK (10 U/uL, M0201, NEB) in a low pH buffer (5X PNK pH 6.5 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Dephosphorylation of cyclic phosphate groups was carried out with T4 PNK (10 U/µL, M0201, NEB) in a low pH buffer (25 mM MES (2-(N-morpholino)ethanesulfonic acid) ...
-
bioRxiv - Biophysics 2021Quote: ... Indel frequencies at the SaCas9 target site were assessed via a T7E1 assay with the EnGen Mutation Detection Kit (NEB), using the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Final Illumina libraries were assessed for quality using an Agilent Bioanalyzer DNA High Sensitivity Assay and qPCR quantification was performed using NEBNext Library Quant kit for Illumina (New England Biolabs). Individual libraries were pooled equimolarly ...
-
bioRxiv - Genetics 2019Quote: ... in accordance with the manufacturer’s recommendations and were validated using the Agilent High Sensitivity DNA assay on the Agilent Bioanalyzer 2100 system and quantified by NEBNext Library Quant Kit for Illumina (New England Biolabs). After clustering of the index-coded samples ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Concentrations were measured by Qubit RNA HS assay kit and 750 ng of Dnase-treated RNA was used for rRNA depletion by NEB Next rRNA depletion kit (Human/Mouse/Rat) ...
-
bioRxiv - Plant Biology 2021Quote: ... All other mutations of the constructs used for in vitro and in vivo assays were introduced using a Q5 site-directed mutagenesis kit (NEB). All constructs were verified by DNA sequencing.