Labshake search
Citations for New England Biolabs :
201 - 250 of 10000+ citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library Kit for Illumina (New England Biolabs) following manufacturers’ protocols ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Genetics 2020Quote: ... and wobble mutations to make constructs resistant to shOTUD5#5 were introduced in this vector using the Q5 site-directed mutagenesis kit (E0554, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA fragments were purified from the reaction using a Zymo DNA Clean & Concentrator-5 kit (in-house) and amplified with NEBNext High Fidelity PCR Mix (NEB). Library quality was assessed using a Fragment Analyzer system (Agilent) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sgRNA was constructed by annealing sense and anti-sense single stranded oligonucleotides containing 5’ Bsa1 restriction overhangs and was inserted into Bsa1 linearized pDR274 with the Quick Ligase Kit (NEB) (Table 1) ...
-
bioRxiv - Genomics 2020Quote: ... The pbp2x 5’-end and 3’-end amplicons were spliced with the linearized pBBL740 amplicon using NEBuilder HiFi kit (New England Biolabs). The resultant spliced plasmid was transformed into parental strain MGAS27213-L601P and single cross-over transformants were selected by plating on THY agar with chloramphenicol 10ug/ml ...
-
bioRxiv - Physiology 2021Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England BioLabs), with 12 cycles of library amplification ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng of high integrity total RNA (RIN >5) was depleted of rRNA using the NEBNext rRNA Depletion Kit (New England BioLabs). NEXTflex Rapid Directional RNA-Seq Kit (Bio-Scientific ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Genetics 2022Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England Biolabs) with 12 cycles of library amplification.
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of purified DNA of each template including the T7 promoter at the 5’ end was used following the manufacturer instructions (HiScribe T7 High Yield RNA Synthesis kit, NEB). Primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis of csn-5(D152N) was performed using a Q5 site-directed mutagenesis kit per manufacturer instructions (New England BioLabs). For transgenic lines used in PLA ...
-
bioRxiv - Cancer Biology 2023Quote: ChIP-seq libraries were prepared using 2-5 ng of input and ChIP samples and the kit NEBNext Ultra DNA Library Prep for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... purified and analyzed to quantify 5-methylcytosine levels by applying the DNA Purification Kit (T3010S, Monarch, New England Biolabs, USA) and the 5mC Assay Kit (lot no ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Cell Biology 2024Quote: ... Synthetic oligonucleotides encoding 3xFLAG were then ligated to the 5’ position of APEX2 sequence using NEBuilder HiFi DNA assembly kit (New England Biolabs) to form the final vector pcDNA5/FRT/TO/3xFLAG-APEX2.
-
bioRxiv - Immunology 2024Quote: ... The PCR amplicon was purified by sequential gel extraction (1.5% agarose gel prepared in 0.5x TAE) and affinity column chromatography (Monarch® PCR & DNA Cleanup Kit, New England Biolabs). For IVT synthesis ...
-
Recurrent loss of crossover interference punctuates the recombination landscape across yeast speciesbioRxiv - Genomics 2024Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... The whole resulting product was then PCR-amplified using indexed primers with NEBNext High-Fidelity 2X PCR Master Mix (NEB). First ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated for 30 minutes shaking at 1.500 rpm at room temperature with protein extract (500 µg of whole cell protein extract or 150 µg of CPE) and murine RNase Inhibitor (NEB) in the corresponding protein extraction buffer (without glycerol) ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Divergent 5’ phosphorylated primers carrying the mutations were used to amplify the whole plasmid and introducer the mutations using the standard Phusion DNA polymerase protocol from NEB. Mutagenesis primers are listed in Supplementary Table 5) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA fragments used in Golden Gate cloning71 were generated via partial/whole-plasmid PCR (Phusion High Fidelity DNA Polymerase, New England Biolabs) or commercially synthesized (gBlocks ...
-
bioRxiv - Biochemistry 2021Quote: ... specific to the 5′ and 3′ RNA adapter sequence (Table 3) and PCR amplified the whole cDNA using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes ...
-
bioRxiv - Biophysics 2021Quote: ... The R525E-R527E mutant plasmid was generated using pET-24a-XccBphP as a template for mutagenesis using whole plasmid amplification followed by DpnI template digestion (New England Biolabs). This was achieved using Q5 High-Fidelity DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... For library generation primers specific to the 5′ and 3′ RNA adapter sequence were synthesized (Table S1) and the whole cDNA was PCR amplified using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes [16] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... It mainly consisted of whole genome library preparation from 100ng of gDNA following NEBNext Ultra II FS (New England Biolabs) recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... Polyadenylated RNA was then isolated from the whole-cell RNA using NEB Oligo d(T)25 Magnetic beads (NEB, S1419S) according to the manufacturers protocol ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase I (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...