Labshake search
Citations for New England Biolabs :
51 - 100 of 10000+ citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 1 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... Total RNA was then isolated from four-day old whole female mosquitoes injected with dsCAPAr or dsARG using the Monarch Total RNA Miniprep Kit (New England Biolabs, Whitby, ON, Canada) and used as template (500ng ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries for whole genome sequencing were prepared with the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England BioLabs, Inc., Ipswich, MA). Libraries were sequenced on a NovaSeq S1 flow cell (Illumina ...
-
bioRxiv - Physiology 2023Quote: mRNA was extracted from mesenteric and renal artery whole cell lysates using the Monarch Total RNA Miniprep Kit’ (New England Biolabs, Ipswich, Massachusetts, USA). The concentration and purity of the RNA samples were calculated using a NanoDrop 3300 Fluorospectrometer with absorbance set to 260nm and 280nm ...
-
bioRxiv - Bioengineering 2023Quote: ... and whole mRNAseq libraries were generated using the NEB Next® UltraTM Nondirectional RNA Library Prep Kit for Illumina® (New England Biolabs, MA), following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... PCR was conducted to amplify the whole sequence (Phusion polymerase, NEB), the amplicon was A-tailed and ligated into a T-tailed version of pICSL86955OD with T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: Whole cell lysate or 5 μL of PURExpress (New England BioLabs) reaction was loaded onto a nitrocellulose membrane (Pall Corporation ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Full length cDNAs were amplified using Q5 High Fidelity DNA polymerase in mastermix format (New England Biolabs Inc., Ipswich, MA, USA). The 50µL reactions contained 25ng cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... Whole mRNAseq libraries were generated using the NEB Next® UltraTM Directional RNA Library Prep Kit for Illumina® (New England Biolabs, MA, USA). The clustering of index-coded samples was then performed on a cBot Cluster Generation System ...
-
bioRxiv - Plant Biology 2023Quote: ... Whole genome enzymatic methyl-seq libraries were prepared using the NEBNext® Enzymatic Methyl seq kit (New England BioLabs® Inc., Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Cell Biology 2023Quote: ... The mCherry-EGFP-GPAT4 (152-208) construct was created using multi-fragment Gibson assembly strategy (NEB, E5510S).
-
bioRxiv - Developmental Biology 2019Quote: ... 5 µl of the whole transcriptome cDNA was PCR amplified using Phusion polymerase (NEB) and 10XPCR1_F (CTACACGACGCTCTT CCGATCT ...
-
bioRxiv - Molecular Biology 2024Quote: ... the whole lysate was incubated with pre-equilibrated oligo(dT)25 magnetic beads (NEB) for 1 h at 4 °C with gentle rotation ...
-
bioRxiv - Biochemistry 2020Quote: ... A C-terminal Twin-Strep tag-coding sequence was added to the second multi-cloning site of pRHJ001 by Q5 site-directed mutagenesis (New England Biolabs) using primers RHJ025 and RHJ026 ...
-
bioRxiv - Genomics 2021Quote: ... into 96-well plate containing 2.5μl of methylase reaction buffer (1 × M.CviPI Reaction buffer (NEB), 2 U M.CviPI (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: PCR mutagenesis was performed by whole plasmid PCR with Q5 high-fidelity polymerase (New England Biolabs) followed by PCR purification (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 μM Illumina barcode (NEB-kit) to 23 μl of cDNA ...
-
bioRxiv - Microbiology 2021Quote: ... we methylated in vitro the whole pLTR-Fluc construct using the SssI methyltransferase (New England Biolabs, M0226). The LTR fragment was then purified ...
-
bioRxiv - Cell Biology 2019Quote: ... Fusions to MBP were obtained by inserting the ORF of CDC24 or its mutants in the multi-cloning site of vector pMAL-c5X (New England Biolabs, Beverly, MA).
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: mRNA was isolated from 6-well plates showing a cell confluency of ∼90% using the Monarch Total RNA Miniprep kit (NEB). siRNA transfection was performed 48 hours prior to RNA isolation using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 uL BsmbI-v2 Golden Gate Assembly Kit (NEB E1602L), and 15.03 uL nuclease free H2O ...
-
bioRxiv - Cell Biology 2021Quote: Whole cell lysates or eluted proteins after affinity purification were treated with Protein Deglycosylation Mix II (NEB, Cat# P6044), according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We engineered the Thrβ119Ser substitution by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... The whole resulting product was then PCR-amplified using indexed primers with NEBNext High-Fidelity 2X PCR Master Mix (NEB). First ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated for 30 minutes shaking at 1.500 rpm at room temperature with protein extract (500 µg of whole cell protein extract or 150 µg of CPE) and murine RNase Inhibitor (NEB) in the corresponding protein extraction buffer (without glycerol) ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Divergent 5’ phosphorylated primers carrying the mutations were used to amplify the whole plasmid and introducer the mutations using the standard Phusion DNA polymerase protocol from NEB. Mutagenesis primers are listed in Supplementary Table 5) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... DNA fragments used in Golden Gate cloning71 were generated via partial/whole-plasmid PCR (Phusion High Fidelity DNA Polymerase, New England Biolabs) or commercially synthesized (gBlocks ...
-
bioRxiv - Biochemistry 2021Quote: ... specific to the 5′ and 3′ RNA adapter sequence (Table 3) and PCR amplified the whole cDNA using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes ...
-
bioRxiv - Biophysics 2021Quote: ... The R525E-R527E mutant plasmid was generated using pET-24a-XccBphP as a template for mutagenesis using whole plasmid amplification followed by DpnI template digestion (New England Biolabs). This was achieved using Q5 High-Fidelity DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... For library generation primers specific to the 5′ and 3′ RNA adapter sequence were synthesized (Table S1) and the whole cDNA was PCR amplified using the NEB Q5 HotStart polymerase (NEB). Secondary PCR was performed to introduce TrueSeq barcodes [16] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... It mainly consisted of whole genome library preparation from 100ng of gDNA following NEBNext Ultra II FS (New England Biolabs) recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... Polyadenylated RNA was then isolated from the whole-cell RNA using NEB Oligo d(T)25 Magnetic beads (NEB, S1419S) according to the manufacturers protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Molecular Biology 2022Quote: PANK3 mutations were made in a gateway compatible pDONR plasmid containing a PANK3 ORF (a gift from the lab of Ben Cravatt) by amplifying the whole plasmid with primers containing the desired mutations and using HiFi DNA Assembly Master Mix (NEB, # E2621) to re-circularize the amplicon ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... the whole shuttle plasmid was PCR-amplified with overlapping primers containing the desired insert and recircularised by NEBuilder (New England Biolabs, #E2621L) recombination.
-
bioRxiv - Immunology 2024Quote: ... and the pHW2000 plasmid backbone such that the whole plasmid could be assembled in a one-pot golden gate reaction with PaqCI (NEB, #R0745S). Due to repeated regions ...