Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Progesterone ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Whole cell lysate or 5 μL of PURExpress (New England BioLabs) reaction was loaded onto a nitrocellulose membrane (Pall Corporation ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5 µl of the whole transcriptome cDNA was PCR amplified using Phusion polymerase (NEB) and 10XPCR1_F (CTACACGACGCTCTT CCGATCT ...
-
bioRxiv - Molecular Biology 2021Quote: ... several hundred cells exhibiting highest fluorescent intensity in the corresponding channel were collected and subjected to whole genome amplification using a commercially available whole genome amplification kit (WGA, New England BioLabs) followed by PCR amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries of the whole MOE tissues were prepared with an NEBNext Ultra Directional RNA kit (NEB) with polyA bead selection ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and whole genome sequencing libraries were prepared using the NEBNext Ultra II Library kit (New England Biolabs) according the recommended protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the libraries for Illumina whole-genome sequencing were prepared with NEBNext master mix kits (New England Biolabs), and the sequencing was done with Illumina HiSeq2000 (Mattila et al ...
-
bioRxiv - Synthetic Biology 2022Quote: ... whole genome sequencing libraries were generated using the NEBNext Ultra II FS DNA Library Prep Kit (NEB) and sequenced using an Illumina NextSeq 500/550 High Output Kit v2.5 (75 Cycles) ...
-
bioRxiv - Genetics 2023Quote: ... Whole genome sequencing libraries were prepared using the NEBNext Ultra II Library kit (New England Biolabs, E7645L) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was extracted from whole coleoptiles at 7dpi using the NEB Total RNA extraction kit (NEB) and following kit instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Colonies were prepared for whole genome sequencing using an Epicentre Masterpure DNA Preparation Kit (Nordic Biolabs, Sweden). Genomic DNA libraries were constructed using Nextera XT Library Preparation Kit (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Whole cells were processed with the “NEBNext Single Cell/Low Input RNA Library Prep” kit (NEB #E6420) by following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... the whole pMZ374 was amplified by NEB Q5 polymerase (using AJ11 and AJ12 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Microbiology 2020Quote: ... Whole genome shotgun libraries were prepared using the NEB Ultra Library Prep kit (New England Biolabs; Ipswich, MA) for sequencing on either the MiSeq or HiSeq (Illumina ...
-
bioRxiv - Genomics 2019Quote: DNA whole genome libraries were prepared using NEBNext® UltraTM II DNA Library Prep Kit (#E7645L, NEB Inc). DNA was quantified on QubitTM 3.0 flourometer using Qubit High sensitivity dsDNA Assay (#Q32854 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Library preparation for whole genome sequencing used enzymatic fragmentation and the NEBNext Ultra II low input kit (NEB) with 150bp paired end on either Illumina HiSeqX or Novaseq machines ...
-
bioRxiv - Genomics 2021Quote: The whole genome bisulfite (WGBS) libraries were prepared using the Ultra II DNA library prep kit (NEB E7645) before being Bisulfite converted using the Zymo EZ DNA Methylation-Gold bisulfite conversion kit according to the protocol described in Vaisvila et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Whole-genome libraries were prepared using the NEBNext® Ultra™ DNA Library Prep Kit (New England Biolabs) and sequenced on a NovoseqPE150 sequencer (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Genomics 2021Quote: ... After determining that some whole fly libraries made using NEBNext Ultra-II DNA library prep kit for Illumina (NEB) were as complete and has better yields than the then discontinued Nextera kit ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We prepared DNA whole genome sequencing libraries using NEBNext UltraTM II DNA Library Prep Kit (Cat. E7645L, NEB Inc.). We quantified DNA on QubitTM 3.0 fluorometer using Qubit High sensitivity dsDNA Assay (#Q32854 ...
-
bioRxiv - Genetics 2023Quote: Whole genome DNA methylation sequencing was performed using the NEBNext Enzymatic Methyl-seq (EM-seq) Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was extracted with a Sodium Dodecyl Sulfate (SDS) protocol from whole bodies and sequencing libraries were built with NEBNext DNA Library Prep Kits (New England Biolabs) by Novogene (Hong Kong).
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted from whole bodies with a SDS protocol and libraries were constructed using NEBNext DNA Library Prep Kits (New England Biolabs). Whole-genome sequencing was performed on Illumina Novaseq 6000 (paired-end mode ...
-
bioRxiv - Genomics 2020Quote: ... we prepared libraries of circle-enriched and whole genomic control samples using NEBNext FS DNA Ultra II Library Prep Kit (New England Biolabs) using protocol modifications outlined in (Sproul and Maddison 2017) ...
-
bioRxiv - Microbiology 2023Quote: ... enough to cover the whole genome (https://artic.network/ncov-2019) and the Q5 TaqPolymerase kit (New England Biolabs, Massachusetts, USA), as previously described [10] ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA from the whole nuclei or nuclear condensate fractions were extracted using genomic DNA extraction kit (New England Biolabs). DNA-seq library was prepared from 50 ng of extracted genomic DNA using Illumina Nextera DNA Library Prep kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ligation product was amplified through 10 reaction cycles to generate a whole genome library (MC library) using NEBNext Ultra II DNA library Prep Kit for Illumina (New England Biolabs) and 750ng MC library was used for exome enrichment ...
-
bioRxiv - Cell Biology 2023Quote: Poly(A)+ RNA was isolated from nuclei and whole cells (see C2C12 cell fractionation above) using the Magnetic mRNA Isolation Kit (New England Biolabs). Two rounds of binding ...
-
bioRxiv - Plant Biology 2024Quote: Whole Methylome Sequencing (WMS) was performed on genomic libraries prepared using the NEBNext Enzymatic Methyl-seq Kit (New England BioLabs) following the manufacturer instructions ...
-
bioRxiv - Genomics 2024Quote: ... 400 ng genomic DNA of each sample was used to construct whole-genome DNA libraries with an NEBNext Ultra II FS DNA Library prep kit (NEB) and NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Plant Biology 2021Quote: Whole-genome enzymatic methyl-seq libraries were prepared using the NEBNext® Enzymatic Methyl-seq kit (New England BioLabs®, Inc.) following the protocol for standard insert libraries (370-420 base pairs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... of extracted RNA (either from whole-cell lysates or sucrose gradient fractions) was performed using the ProtoScript II First Strand cDNA Synthesis Kit (NEB E6560L) according to the manufacturer instructions with some modifications ...
-
bioRxiv - Genomics 2023Quote: ... and then prepared into a whole-genome shotgun library using the NEB Ultra Library Prep kit (New England Biolabs; Ipswich, MA). Instead of the standard Illumina library prep adaptor ...
-
bioRxiv - Cancer Biology 2024Quote: ... Whole exome library construction was generated using the NEB Next® Ultra RNA Library Prep Kit for Illumina (E7530L, NEB, USA) after DNA shearing ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit) followed by a 1 h incubation at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Whole-plasmid amplification reactions were performed using Phusion polymerase (NEB) and Ampligase (Epicentre) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100bp strand-specific whole transcriptome libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs, Herfordshire, UK), following rRNA depletion with NEBNext rRNA Depletion Kit or Ribo-Zero Gold ...
-
bioRxiv - Genetics 2019Quote: We constructed individually barcoded whole genome shotgun libraries using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA) and 6-bp custom indexed primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified RNA was submitted to the University of Virginia Genome Analysis and Technology Core for whole transcriptome sequencing by first library preparation with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB Cat #E7760) and then sequencing by Illumina NextSeq 500 Sequencing System for paired-end 75bp reads ...
-
bioRxiv - Microbiology 2022Quote: DNA was isolated from 100 µL of whole blood using the blood protocol from the Monarch® Genomic DNA Purification Kit (New England Biolabs, Australia). In addition ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Whole-genome libraries were prepared using the NEBNext Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, USA) with modifications for subsequent target enrichment ...