Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Progesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit) followed by a 1 h incubation at 25°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NNN spacer to increase library diversity during sequencing (preadenylated oligos were prepared by 5’ DNA adenylation kit (E2610L) using thermostable 5’ App DNA/RNA ligase (M0319L, both from New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Molecular Biology 2020Quote: This oligonucleotide was adenylated using the 5’ DNA adenylation kit (NEB, E2610S) as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Molecular Biology 2019Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Biophysics 2020Quote: We used in vitro mutagenesis (Q-5 Site-directed Mutagenesis Kit, NEB) to introduce the mutations creating d isoforms using the following primers ...
-
bioRxiv - Genetics 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligas’ 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.6 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 15% PEG ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adenylated 3’ adapter was prepared using the 5’ DNA adenylation kit (NEB) and ligated using T4 RNA ligase 2 ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Bioengineering 2023Quote: ... for the ligation rounds are added to 96 well plates and their 5’ ends phosphorylated with T4 Polynucleotide Kinase (NEB). After 5’ phosphorylation ...
-
bioRxiv - Immunology 2019Quote: ... followed by site-directed mutagenesis using the Q-5 kit (New England Biolabs) in order to generate point mutations into MIC1 (MIC1-T126A/T220A ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenylation of R1R was done using 5’ DNA Adenylation kit (New England Biolabs) according to manufacturer’s instructions and cleaned with Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Genetics 2020Quote: ... and purified with Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, Ipswich, USA), checked on an 1 % (w/v ...
-
bioRxiv - Biophysics 2023Quote: ... DNA was purified using Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Immunology 2022Quote: ... The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7). In brief ...
-
bioRxiv - Microbiology 2019Quote: ... Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs GmbH; Ipswich, USA), or innuPREP DOUBLEpure Kit (Analytik Jena ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-gaattcgatgtgtaggctggag-3’ using Gibson assembly technique (kit was purchased from New England Biolabs), to yield pIJ773-Δspt9 ...
-
bioRxiv - Microbiology 2019Quote: ... the 3’ adapter-ligated DNA fragments were adenylated using 5’ DNA Adenylation Kit (NEB) in a 20-μl reaction following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... The DNA/RNA hybrid strand was pre-adenylated with DNA 5’ Adenylation Kit (NEB) and purified with Oligo Clean & Concentrator (Zymo) ...
-
bioRxiv - Immunology 2022Quote: ... cleaned and concentrated 20x using the Monarch PCR & DNA Cleanup Kit (5 µg) (NEB). Further cleanup was done with the E-gel imager system (Invitrogen ...
-
bioRxiv - Pathology 2024Quote: ... 5 min ice) and plasmids were extracted using the Monarch Plasmid Miniprep kit (NEB) following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: ... 5’UTR Nr4a1 mutant was made using Q5® Site-Directed Mutagenesis Kit (NEB BioLabs) according to the manufacturer protocol ...