Labshake search
Citations for New England Biolabs :
351 - 400 of 1195 citations for Prestained Protein Standards since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 50 μg of purified protein complexes were treated with 2,000 U of Lambda Protein Phosphatase (New England Biolabs) in 200 μl dephosphorylation buffer (50 mM HEPES-NaOH ...
-
bioRxiv - Systems Biology 2023Quote: ... the wild-type protein extracts were incubated with 40 units of Lambda Protein Phosphatase (New England Biolabs, P0753S) at 30°C for 30min ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The second plasmid is edited from the above mentioned pUC19-PCN library by inserting a single competitor via standard Site-Directed Mutagenesis(NEB, E0554). Two plasmids were co-transformed into GL002 strain that has dFnCas12a and TetR integrated in its genome with Mix & Go! E.coli Transformation Kit(T3001) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... NEB 10x Standard Taq Reaction buffer (100 mM Tris-HCl, 500 mM KCl, 15 mM MgCl2, pH 8.3) (New England Biolabs, Ipswich, MA), 2× PCR reaction mix (2× Standard Taq Reaction buffer ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified PCR products were ligated into the recombinant plasmid pZE0-P-MglE-T using the recommended standard USER cloning protocol (NEB, UK).
-
bioRxiv - Genomics 2020Quote: ... The resulting fragment is then ligated into a digested pCDNA3-YFP Basic plasmid that had been cut with Kpn1 and Xho1 using a standard T4 DNA Ligase protocol (NEB #M0202). Once the insert ...
-
bioRxiv - Immunology 2019Quote: ... PCR amplification was performed using Taq DNA Polymerase with Standard Taq Buffer according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA). The PCR product was inserted into pCR™ 2.1-TOPO® TA Cloning® plasmid according to the manufacturer’s protocol (Invitrogen™ ThermoFisher Scientific ...
-
bioRxiv - Physiology 2019Quote: ... using the Primer3 plugin in Geneious® 6.1.8 (Biomatters Ltd., Auckland, New Zealand) were amplified using standard Taq DNA Polymerase (New England Biolabs, Whitby, ON) following manufacturer-recommended conditions ...
-
bioRxiv - Systems Biology 2019Quote: ... REV: TTACTTCGCTGTCATCATTTGTACAAACTCTTCGTAG) pEntry_GCaMP5G was linearized with PCR reaction using standard Phusion® Hot Start Flex 2X Master Mix (NEB Cat# M0536L) protocol (FOR ...
-
bioRxiv - Cell Biology 2021Quote: The recovery probe was prepared as follows: A standard 100 µl PCR reaction was prepared containing 10 ng of bacteriophage λ DNA (NEB), 5 units of Taq polymerase (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse (ccagtgagcttcccgttca) primers with Q5 High fidelity DNA polymerase according to the standard protocol described by the manufacturer (New England BioLabs®). The PCR products obtained after 35 cycles were separated through a 1% agarose gel ...
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of libraries prior to sequencing used qPCR with primers specific to the Illumina P5 and P7 adaptor sequences and standards from the NEBNext Library Quant Kit (NEB, E7630S). Sequencing of prepared libraries was performed using an Illumina MiniSeq with the 75-cycle high-output kit ...
-
bioRxiv - Microbiology 2021Quote: All cDNA was made by following the “First Strand cDNA Synthesis” standard protocol provided by New England Biolabs with their AMV Reverse Transcriptase (New England Biolabs, M0277L). Random hexamers (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... MmnI in this paper) as candidate genes by searching against a gold-standard dataset in the Restriction Enzyme Database (NEB REBASE) (21) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The template for probe synthesis was generated through two rounds of standard PCR method using OneTaq® 2x Master Mix (New England Biolabs, NEB): the first PCRs from cDNA used the gene-specific primers including the T7 linker sequence ...
-
bioRxiv - Microbiology 2021Quote: ... Resolved strains (GFP-negative and kanamycin-sensitive) were tested for the desired genotype by colony PCR (OneTaq® 2X Master Mix with Standard Buffer, New England Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Microbiology 2019Quote: ... the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs, Germany) at 72°C annealing temperature ...
-
bioRxiv - Microbiology 2019Quote: ... we used the aforementioned primers M13/pUC Forward and L4440 Reverse and the isolated plasmid (template) in a OneTaq® 2X Master Mix with Standard Buffer (NEB) reaction as recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2019Quote: Production of new plasmids for this study was accomplished by standard restriction-ligation or NEBuilder HiFi DNA Assembly (New England Biolabs E5520S), typically using Clontech pEGFP-C1 and -N1 backbones or their derivatives ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Standard PCR-based amplification to add overlap-adaptors and Gibson-style assembly methods (HiFi Assembly Kit, New England Biolabs, Ipswich, Massachusetts) were used to assemble the final vectors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... A 25 μl of reaction was set with standard 1X reaction buffer premixed with 1.5 mM MgCl2 (New England BioLabs® Inc.), 0.25mM of dNTPs (Bangalore Genei ...
-
bioRxiv - Microbiology 2019Quote: ... plus 280 nM each primer and the standard reagents in the Phusion High-Fidelity PCR Kit (New England BioLabs, Ipswich, MA). Samples were then cycled under the following qPCR conditions ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Synthetic Biology 2021Quote: minD,minE and FtsA genes were amplified by standard polymerase chain reaction (PCR) amplified using Phusion High-Fidelity DNA polymerase (New England Biolabs, USA) as previously reported24,30 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis was carried out with a standard oligo-dT primer protocol using the ProtoScript II First Strand cDNA Synthesis Kit (NEB E6560). RNA concentrations were normalized between samples prior to reverse transcription ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 µL of the supernatant was used as a template for the PCR reaction using OneTaq® 2X Master Mix with Standard Buffer (New England Biolabs) primers 4925 and 4926.
-
bioRxiv - Microbiology 2023Quote: ... Resolved strains (GFP-negative and kanamycin-sensitive) were tested for the desired genotype by colony PCR (OneTaq® 2X Master Mix with Standard Buffer, New England Biolabs). All the plasmids are listed in Table 2.
-
bioRxiv - Microbiology 2023Quote: ... using a minimum of 20 bp overlapping regions between DNA fragments with custom made kit Plasmid selection and verification after the transformation were checked using the OneTaq® 2X Master Mix with Standard Buffer (NEB). Plasmids were purified using the Qiagen plasmid purification kit according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... New plasmids used in this study were generated using standard restriction-ligation or by using NEBuilder HiFi DNA Assembly (New England Biolabs E552OS). HsPIP5K1A ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was then used for PCR with the OneTaq 2x Master mix with Standard Buffer (New England Biolabs, Ipswich, Massachusetts). Targets for differential editing of the mutant in p150 and p110 were ...
-
bioRxiv - Genomics 2024Quote: ... Purified product was Gibson cloned into a previously described PiggyBac transposon vector (37) using standard protocols in a 10 μl reaction (NEB E2621S). 2.5 μl of the Gibson reaction was electroporated into 25 μl of 10-beta electrocompetent E ...
-
bioRxiv - Cell Biology 2020Quote: ... in protein kinase buffer (New England Biolabs) in the presence of 0.2 mM Mg2+-ATP and 1 µCi [γ32-P]ATP for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... in protein kinase buffer (New England Biolabs) and 0.5 mM Mg2+-ATP for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Physiology 2022Quote: ... The Cas9 protein was purchased from NEB. Mixture of sgRNA (100 pg ...
-
bioRxiv - Immunology 2022Quote: ... 1μl of Lambda Protein Phosphatase (NEB, P0753S) was added and samples were incubated at 30°C for 30 minutes ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... Proteins were transferred to nitrocellulose membranes (Biolabs). Membranes were then incubated with primary antibody diluted in 2.5% milk or 2.5% BSA in Triton X-100-TBS buffer (T-TBS ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...
-
bioRxiv - Plant Biology 2021Quote: ... Lambda protein phosphatase treatment (New England BioLabs) was performed following the manufactorer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Lambda protein phosphatase (New England BioLabs, P0753S) was used per product instructions.
-
bioRxiv - Pathology 2021Quote: Magnetic protein G beads (New England Biolabs) were blocked in antibody selection buffer and used to immobilize 10-15μg polyclonal rabbit anti-VWF (Dako A0082 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were degraded using proteinase K (NEB) and RNA was purified using RNeasy maxi kit (Qiagen).
-
bioRxiv - Developmental Biology 2022Quote: ... EnGen Spy Cas9 NLS protein (NEB, M0646) was used for F0 experiments.
-
bioRxiv - Microbiology 2023Quote: ... coli Protein Synthesis System (New England Biolabs), then purified with Ni-NTA beads (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... gRNAs and Cas9 protein (NEB, cat# M0251S) were simultaneously injected into the embryos at one-cell stage.
-
bioRxiv - Cell Biology 2024Quote: ... Protein A magnetic beads (New England Biolabs) were saturated with rabbit-anti-GFP ...
-
bioRxiv - Microbiology 2024Quote: ... coli protein synthesis system (New England Biolabs) was used for in vitro protein expression ...
-
bioRxiv - Cell Biology 2021Quote: Whole cell lysates or eluted proteins after affinity purification were treated with Protein Deglycosylation Mix II (NEB, Cat# P6044), according to the manufacturer’s protocol ...