Labshake search
Citations for New England Biolabs :
1 - 50 of 888 citations for Polyoxymethylene Homopolymer 20% PTFE Fiber Filled Granule since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... initial digestion of DNA extracted from SDGC-SEC-purified stress granule cores was performed using exonuclease VIII (truncated, New England Biolabs; 20-30 units per μg of DNA) from 4 to 15 hours at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... The marker well is filled with 20 µL of a 1:40 dilution of 100 bp ladder (NEB N3231L). The gel is run on an E-Gel Power Snap Electrophoresis Device (ThermoFisher G8100 ...
-
bioRxiv - Neuroscience 2021Quote: RNA was collected from cultured granule cells using the Monarch® Total RNA Miniprep Kit (NEB). Then cDNA was reverse transcribed using SuperScript™ IV First-Strand Synthesis System (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... Restriction overhangs were filled-in with Klenow (NEB) using biotin-14-dATP (Jena Bioscience) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Restriction fragment ends were filled in using Klenow (NEB) with dCTP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Protruding 5’ ends were filled in with Klenow enzyme (NEB) in the presence of [P]-32 dCTP (Hartmann Analytics ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min75 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Annealed oligonucleotides were filled with T4 DNA Polymerase (New England Biolabs) for 20 min at 11 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... the ssDNA overhangs were filled in with T4 DNA polymerase (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA fragment overhangs are filled with Klenow Fragment (3’-5’ exo-) (NEB) to leave an A-overhang ...
-
bioRxiv - Cell Biology 2023Quote: ... EcoRI and XbaI 5’ overhangs were filled in with dGTP (New England Biolabs), dCTP (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The ssDNA overhangs were filled-in with T4 DNA polymerase (New England BioLabs) to generate dsDNA ...
-
bioRxiv - Genomics 2024Quote: ... The biotin-filled DNA fragments were ligated by T4 DNA ligase (NEB,M0202L) for 4 h at 16 °C ...
-
bioRxiv - Genomics 2020Quote: ... the UMI complemental region (BBBBBBBB) was filled with Phusion High-Fidelity DNA polymerase (NEB) and dVTPs (dATP/dGTP/dCTP ...
-
bioRxiv - Developmental Biology 2024Quote: ... were annealed together and ssDNA overhangs were filled in using T4 DNA polymerase (NEB). The resulting sgRNA template was purified using DNA Clean and Concentrator Kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The ends of the annealed UMI Adaptor were filled in using Klenow (New England Biolabs). The reaction was stopped with EDTA and heat ...
-
bioRxiv - Biophysics 2022Quote: ... These filled-in primers are then amplified by PCR with One-Taq DNA polymerase (NEB) and two 21-base primers (HTOP and HBOT ...
-
bioRxiv - Molecular Biology 2020Quote: ... the ends of the NcoI/BsrGI-digested plasmid were filled with T4 DNA polymerase (NEB) according to the manufacturer’s protocol and blunt ends were re-ligated ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA ends were filled and repaired using NEB Ultra II end-repair module (NEB #E7645), with adapters ligated sequentially to the sonicated ...
-
bioRxiv - Biophysics 2024Quote: ... the remaining gap on the upper strand was filled with T4 DNA polymerase (M0203S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... These custom carbon fiber microelectrodes have passed a successful Ethylene Oxide Sterilization Exposure and Sterility Audit conducted by BioLabs to ensure preoperative ethylene oxide treatment fully sterilizes the carbon-fiber microsensor electrodes ...
-
bioRxiv - Microbiology 2022Quote: ... each chamber is filled for 30 min with a 1 mg/ml solution of Streptavidin (NEB) and then passivated with a blocking solution (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Genetics 2023Quote: ... The annealed oligos were then Klenow filled by combining 0.8 μl Klenow polymerase (exonuclease negative, NEB) with 1.35 μl of 1mM dNTPs with 40 μl of product to fill in the barcode oligo ...
-
bioRxiv - Biophysics 2022Quote: ... the cleaved single-stranded DNA was filled in to make duplex by Bst 2.0 warmstart polymerase (NEB) at 65°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The annealed oligo was filled in using T4 DNA polymerase (New England BioLabs, M0203S, Ipswich, MA, USA), PCR amplified ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digested DNA fragments were filled in with biotin-labeled dATP by incubating with Klenow enzyme (NEB, M0212), biotin-14-dATP ...
-
bioRxiv - Biophysics 2023Quote: The cohesive ends of lambda phage DNA (SRL #67291) were filled using a Klenow fragment (NEB #M0210L) with dATP ...
-
bioRxiv - Genomics 2024Quote: ... Digested DNA fragments were filled in with biotin-labeled dATP by incubating with Klenow enzyme (NEB, M0212), biotin-14-dATP (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: ... Transposed DNA was gap-filled by addition of 4μL gap-fill mix (3.2 μL Q5 reaction buffer (NEB), 0.07 μL 1M MgCl2 ...
-
bioRxiv - Genomics 2023Quote: ... Gaps in the transposed DNA were filled by 4μL gap-filling mix (3.2 μL Q5 reaction buffer (NEB), 0.07 μL 1M MgCl2 ...
-
bioRxiv - Genomics 2023Quote: ... Gaps in the transposed DNA were filled by 15μL gap-fill mix (7 μL Q5 reaction buffer (NEB), 7 μL Q5 high GC enhancer (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... The two primers are annealed and the single strand overhangs are filled in using One-Taq DNA polymerase (NEB). These filled-in primers are then amplified by PCR with One-Taq DNA polymerase (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Filled-in chromatin was then ligated by adding 970 μl of Ligation Master Mix (150 μl of 10x NEB T4 DNA ligase buffer with ATP (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid pEC095 was digested with BtsBI and the 5’ overhanging DNA ends were filled in with T4 Polymerase (NEB). A kanamycin resistance marker ...
-
bioRxiv - Genomics 2022Quote: ... and 20 μl of HindIII (NEB, 20 units/μl) were added to the nuclei pellet and digested for 1.5 h at 37 °C in thermomixer (Eppendorf ...
-
bioRxiv - Molecular Biology 2020Quote: ... A nick at the anticodon end of the DNA-RNA hybrid was filled using T4 DNA ligase and SplintR ligase (NEB). MyOne-C1 Streptavidin Dynabeads (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Capillary tubes (0.025⍰mm inner diameter) were filled with either 0.5⍰mM hemin or 0.5⍰mM S-adenosylmethionine (SAM) (New England Biolabs, Ipswich, MA) in the motility buffer and sealed with vacuum silicone grease (Dow Corning ...
-
bioRxiv - Neuroscience 2020Quote: The constant oligomer and the gene specific oligomer were annealed on a PCR machine and filled in using T4 DNA polymerase (NEB) (Gagnon et al. ...
-
bioRxiv - Biophysics 2021Quote: ... Two experiments were conducted in which the vacuum filling of the channels with buffer was followed by a heating/diffusion step of 1 hour at 40°C with the reservoir filled with a solution containing both DNase I (at 0.096U/μl) and BSA (NEB B9000S) at 0.13mg/ml or 0.40mg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... the protruding ends generated by the restriction digestion were filled in by 0.13 U/uL Klenow fragment (New England Biolabs, M0210) treatment at 37°C for 45 minutes in the presence of 50 µM biotinylated deoxyadenosine triphosphate (biotin-14-dATP ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl proteinase K (20 mg/ml) (New England Biolabs) and 25 μl 10sSodium dodecyl sulphate (SDS ...
-
bioRxiv - Genetics 2022Quote: ... ds-DNA was constructed from two oligos that are annealed and 5’ overhangs filled in using Klenow polymerase according the manufacture’s specifications (NEB cat. M0210L). All yeast transformation were carried out using the lithiumacetate method ...
-
bioRxiv - Microbiology 2024Quote: ... The 12 μl of size-selected metagenomic DNA fragments were gap-filled by the addition of 12 μl of 2x Q5 DNA polymerase (New England Biolabs, M0492S) (pre-incubated at 98°C for 30 seconds ...
-
bioRxiv - Cancer Biology 2024Quote: ... the tyr oligo template (CCTCCATACGATTTAGGTGACACT ATAGGACTGGAGGACTTCTGGGGGTTTTAGAGCTAGAAATAGCAAG) and the constant oligonucleotide (AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGC CTTATTTTAACTTGCTATTTCTAGCTCTAAAAC) were annealed and filled in with T4 DNA polymerase (New England BioLabs, M0203S). The product was PCR amplified ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting single-stranded (filled-in) DNA was then gel purified and ligated with T4 DNA ligase (New England Biolabs, M0202) before transformation into Stbl3 competent cells (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... sticky ends were filled by incubating the nuclei for 4h at RT with DNA Polymerase I (New England Biolabs, Cat. N: M0210) and a biotin-14-dATP (Life Technologies ...
-
bioRxiv - Biophysics 2023Quote: ... For each sample a separate chamber with closed nanosensors was prepared and filled with 1×CutSmart™ buffer (New England BioLabs, USA) containing 50 mM potassium ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 mM RVC (NEB), 0.1 mg/mL salmon sperm DNA (Thermo Fisher)] with agitation at 40 °C overnight ...
-
bioRxiv - Genetics 2022Quote: ... 20 μL Phusion (NEB) reactions were set up according to manufacturer’s protocol with primers MK193 ...
-
bioRxiv - Genomics 2020Quote: DpnII digest:20 ug genomic DNA + 20 uL DpnII buffer (New England Biolabs) + 4 uL DpnII 9New England Biolabs ...