Labshake search
Citations for New England Biolabs :
201 - 250 of 308 citations for Phospho Tyrosine Rabbit Polyclonal HRP labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE, NEB) in the presence of GTP and S-adenosylmethionine (SAM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Microbiology 2021Quote: ... was dephosphorylated and 5’ end labeled with P32 as follows: 25 pmol of RNA was dephosphorylated using 50U of Antarctic Phosphatase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the strands of each sequence was then labeled with P32 as follows: 10 pmols of single stranded DNA was incubated with 5 Units of T4 PNK (NEB) and 0.64µCi of P32- γ -ATP (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-protein complexes were radioactively labeled with 32P-γ-ATP (20 μCi) using 40U T4 Polynucleotide Kinase (New England Biolabs) in supplied PNK buffer for 30 min at 37ºC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... pJET1.2 plasmids containing 150 bp FCR monomer sequences were PCR-amplified and fluorescently labeled using random hexamer priming and Klenow (exo-) polymerase (New England Biolabs). Both Alexa Fluor 488 and 568 dUTP-conjugated fluorophores were used ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Immunology 2020Quote: ... A 32P-labeled 368 nt transcript was generated from EcoRI digested probe temple (described below) using T7 RNA polymerase (New England Biolabs). The probe was diluted in the hybridization buffer described above ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 pmol of oligonucleotide was labeled at the 5’ terminus with 0.05 mCi [γ-32P]-ATP using T4 Polynucleotide Kinase (New England Biolabs). For annealing ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 20picomoles of CIP treated RNA was 5’ end labeled with 50μCi of [γ-32P] ATP (10mCi/ mL, BRIT, India) by incubating with T4 polynucleotide kinase (New England Biolabs) at 37°C for 35 min ...
-
bioRxiv - Biophysics 2019Quote: ... and 15-25 μM of BG-oligonuculeotides were labeled with ∼ 1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Zoology 2020Quote: ... Each gel also contained 32P-end-labeled size ladders (Molecular Weigh Marker XV, by Roche Diagnostics and 1Kb DNA ladder by New England Biolabs). After electrophoresis ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB) and amplified 7 cycles by PCR in the presence of SYBR Green in order to obtain an optimal yield ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB) and amplified 9-13 cycles (depending on initial material amount ...
-
bioRxiv - Molecular Biology 2020Quote: ... tRF-5s, itRFs were end-labeled with 32P-ATP (Board of Radiation and Isotope Technology, India) using polynucleotide kinase (NEB), purified through MicroSpin G-25 Columns (GE Healthcare) ...
-
bioRxiv - Biophysics 2021Quote: ... and 15–25 μM BG-oligonuculeotides were labeled with ∼1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa-CENP-A-SNAP cells were grown in 6 well plates and pulse labeled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4µM final concentration ...
-
bioRxiv - Biochemistry 2022Quote: ... a tolerant position was mutated to facilitate making a labeled LexA variant.56 The His-LexA W201C mutant was generated using a Q5 Site-Directed Mutagenesis Kit (NEB) and the mutation was confirmed via sequencing ...
-
bioRxiv - Genomics 2022Quote: The 2.2 kb DNA was ligated with 1 kb biotin- and dig-labeled DNA through SbfI- and XbaI-overhangs by T4 DNA ligase (NEB Biolabs). The ligated products were attached to the anti-dig treated surface of reaction chamber and streptavidin-coated magnetic beads ...
-
bioRxiv - Genomics 2022Quote: ... Two 500 ng reaction tubes of DLE1-labeled DNA were each mixed with 4 μL of 10X CutSmart buffer (New England Biolabs), 60 μM of lab-made synthetic AdoYnATTO643 (see synthesis in the Supplementary Data) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The products were analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel against a 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) and quantitated with a phosphorimager (Typhoon FLA 9500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel with 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) run in a parallel lane ...
-
bioRxiv - Neuroscience 2022Quote: 4 µl procainamide-labeled glycans were combined with 1 µl 10x sodium acetate – Ca2+ buffer (Glycobuffer 1, New England Biolabs), 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 pmol of dephosphorylated and purified RNA was 5′ end-labeled (20 μCi of 32P-γATP) using 1 U of Polynucleotide Kinase (NEB) for 1 h at 37 °C in a 20 μL reaction volume ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 200 µL of phosphate saline buffer (PBS) and labeled by incubation with SNAP-cell TMR-Star (New England Biolabs) for 30 min at 37°C in the dark at a final concentration of 250 nM ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng of Cy5-labeled and biotinylated DNA was incubated with 1 μg of streptavidin (SA, New England Biolabs, #N7021) in 25 μL of binding buffer (10 mM Tris-HCl ...
-
bioRxiv - Microbiology 2023Quote: ... and oligonucleotides crp500F and crp500R (one of which was labeled with [γ32P]ATP by use of T4 polynucleotide kinase (NEB)) ...
-
bioRxiv - Microbiology 2023Quote: ... and FAM-labeled TaqMan probe were used in viral negative strand quantification with Luna Universal Probe qPCR Master Mix (New England Biolabs). The reactions were run under the cycling conditions as follows ...
-
bioRxiv - Biochemistry 2023Quote: Both native and modified oligonucleotides were 5’-32P labeled by [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs) following manufactures recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: Total SNAP-tagged histones were labeled by incubating cells with 2 µM of the red-fluorescent reagent SNAP-cell TMR-star (New England Biolabs) for 15 min before cell fixation ...
-
bioRxiv - Biophysics 2023Quote: ... cells were labeled for 30 min at 37° C with 1 µM Surface BG-Alexa546 (impermeable dye; New England Biolabs) for SNAP in extracellular buffer (EX ...
-
bioRxiv - Biochemistry 2023Quote: ... The oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted as described above with the addition of a second in vitro transcribed 4sU-labeled (10% of UTP was exchanged for 4sUTP in the T7 RNA polymerase in vitro reaction (NEB)) spike-in ERCC-00136 ...
-
bioRxiv - Microbiology 2023Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ- 32P]-ATP (150 µCi) ...
-
bioRxiv - Genomics 2024Quote: ... Two 500 ng reaction tubes of DLE1-labeled DNA were each mixed with 4 µL of 10X CutSmart buffer (New England Biolabs), 60 µM of lab-made synthetic AdoYnATTO643 (Margalit et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Neuroscience 2024Quote: ... DIG- and FITC-labeled antisense RNA probes were generated from 1 µg of linearized plasmid template using T7 or Sp6 RNA polymerases (NEB) and DIG-11-UTP (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Both ends of the 19-mer of the 200 bp 601 DNA were labeled with biotin by Klenow fragment (NEB) with biotin-14-dATP (58) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The biotin labeled nuclei were washed once with 1x NEB ligation buffer and resuspended with ligation mix (100 ul 10x NEB ligation buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligos (20 pmoles) were labeled at their 5’ ends using gamma-32P-rATP (3000 Ci/mmole) and polynucleotide kinase (New England Biolabs), and purified on 7M urea ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Systems Biology 2022Quote: ... anti-SNAP (1:1000, rabbit, NEB, P9310S); anti-MRPS18B ...
-
bioRxiv - Synthetic Biology 2023Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and rabbit anti-NANOG (New England Biolabs). Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicons were end-labeled with [γ-32P] dATP (Perkin-Elmer) in the presence of T4 polynucleotide kinase (New England BioLabs), after which they were centrifuged through a TE Select-D G-25 spin column (Roche Applied Science ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were complimentary to the 3′-UTR regions immediately adjacent to the poly(A) tails and were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...