Labshake search
Citations for New England Biolabs :
51 - 100 of 130 citations for Peptide B since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...
-
bioRxiv - Genetics 2020Quote: ... 2.5 μL of Taq Buffer B (Mg-free; 10X) (New England Biolabs, Ipswich, MA, USA), 2.5 μL of dNTPs (2.5 mM of each base) ...
-
bioRxiv - Bioengineering 2023Quote: These inserts were then cloned into the pSECRETS-B cassette via USER cloning (NEB #M5505S). To maintain library diversity ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Synthetic Biology 2021Quote: ... DNA templates for MS-QBiC peptide synthesis were amplified by PCR using Taq DNA polymerase (NEB) with a T7 promoter primer (5′-GGGCCTAATACGACTCACTATAG-3′ ...
-
bioRxiv - Biochemistry 2020Quote: ... Desalted peptides were dissolved at a concentration of 3 µg/µL in 1x CutSmart buffer (NEB, 50 mM potassium acetate ...
-
bioRxiv - Cell Biology 2022Quote: ... enzyme digestion or Peptide-N-Glycosidase F (PNGase F) (New England Biolabs, Ipswich, MA, catalog #: P0704L) enzyme digestion was performed according to manufacturer’s instruction and the published procedure [49].
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: Lysine-succinylated peptides were enriched using agarose-conjugated pan anti-succinyllysine antibody (PTM Biolabs, Hangzhou, China). In brief ...
-
bioRxiv - Molecular Biology 2020Quote: ... pUHES:UmPit2+SP:mCherry with its natural signal peptide was generated via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) by combining PCR-amplified UmPit2+SP:mCherry using primers 2127 + 2128 and PCR-amplified pUHESdest using primers 2125 + 2126 without UhAvr1 signal peptide ...
-
bioRxiv - Cell Biology 2020Quote: ... These peptides were used as the substrate in a PKA kinase assay kit (New England Biolabs, #P6000S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... These peptides were used as the substrate in a PKA kinase assay kit (New England Biolabs, #P6000S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... then deglycosylated with 2000 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA). All samples were incubated for 16 hours at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 of α2-3,6,8,9 Neuraminidase A (New England Biolabs, Fig. 2d and Extended Data Fig. 2a,b) were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... Dissolved peptides were incubated with antiKcr antibody-coated agarose beads (Catalog No. PTM-503, PTM Biolabs, Hangzhou, China) overnight at 4 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Peptide constructs were assembled and integrated upstream of Venus using the NEBuilder HiFi Assembly kit (New England Biolabs). Correct assembly was verified by sequencing of inserts and flanking regions ...
-
bioRxiv - Biochemistry 2021Quote: ... primers containing overhangs of the 3x FLAG peptide were phosphorylated using the T4 polynucleotide kinase (New England BioLabs). Phosphorylated primers were used to PCR amplify pQLinkN-pgaD to generate the plasmid pQLinkN-pgaD-FLAG ...
-
bioRxiv - Microbiology 2021Quote: Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
bioRxiv - Microbiology 2020Quote: ... HI.fate vectors expressing the Zs-Green protein fused to EGFP through the 2A self-cleavage peptide were constructed by digesting HI.fate.E with BsiW I and Xho I restriction enzymes (NEB) and cloning two fragments ...
-
bioRxiv - Microbiology 2023Quote: ... Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and about 200 ng of DNA was digested with the type II b enzyme BcgI (New England Biolabs). This enzyme cuts both upstream and downstream of the 6 bp recognition site ...
-
bioRxiv - Microbiology 2020Quote: ... The pSAG1:U6-Cas9:sgRNA-TgIF2K-B vector was generated using Q5 site-directed mutagenesis (New England Biolabs) (26 ...
-
bioRxiv - Microbiology 2023Quote: Five POWV-LI9 fragments were amplified from viral cDNA (Figure 1A,B) using high-fidelity Phusion polymerase (NEB) and corresponding paired primers (Table S2 ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were isolated from fixed B cells and subjected to in situ digestion using 200U MboI (NEB, R0147M) for 4 hours at 37 ºC ...
-
bioRxiv - Genetics 2023Quote: ... 1.2 M sorbitol) and resuspended in digestion buffer (Buffer B, 200 mM Vanadyl ribonucleoside complex [VRC from NEB] ...
-
bioRxiv - Physiology 2021Quote: ... The biotinylated peptides were placed on streptavidin-coated plates and three rounds of solid-phase panning were conducted using 109 random 12-mer peptides fused to a minor coat protein of M13 (pIII) following the manufacture’s protocol (Ph.D-12 Phage Display Peptide Library Kit, NEB, E8110S). Sequenced data were subsequently analyzed as follows ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 1 mM MnCl2 was used to remove the phosphorylation on the peptides and Staurosporin (NEB, Hitchin, UK) to occupy the active site pocket ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DOM-A and DOM-B K945G mutants were generated by site-directed mutagenesis (New England Biolabs, Cat. No E0554S). For transfection in Drosophila cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was sheared by incubating the nuclei in 100 µl of buffer B supplemented with 1,000 units of micrococcal nuclease (M0247S; NEB) for 30 min at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 8 μL of solution A and 6 μL of solution B were mixed with 16 U RNase Inhibitor (NEB), gBlock templates (2 nM each ...
-
bioRxiv - Genomics 2023Quote: ... Then equal amounts of purified linear A and B PCR products were mixed with the Taq DNA ligase (NEB) and its buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... We first joined sequences for fluorescent protein mCerulean (CFP) and 2A peptide P2A (a ribosomal skip sequence) with Q5 (NEB) fusion PCR and added them to the pWPXL vector with Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Bioengineering 2020Quote: ... Respective peptide DNA coding sequences (CDS) were amplified from hACE2 via PCR and inserted using HiFi DNA Assembly Master Mix (NEB) for Gibson Assembly into the pcDNA3-SARS-CoV-2-S-RBD-Fc backbone linearized by digestion with NheI and BamHI ...
-
bioRxiv - Biochemistry 2022Quote: ... the sequence for the 50-residue hinge-region “C-peptide” (Ala317-Phe366) was removed via site directed mutagenesis (New England Biolabs). The construct further included the miniGs399 protein15 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3-FLAG-PKCα constructs expressing FLAG-tagged PKCα were generated by amplifying the coding region of PKCα from HeLa Tet-off cell total RNA and inserting it into pcDNA3-FLAG (45) immediately downstream of the FLAG peptide sequence using Gibson Assembly (NEB). Constitutive active PKCα-AE was generated by mutating alanine 25 into glutamic acid ...
-
bioRxiv - Developmental Biology 2022Quote: ... and zebrafish cachd1 ectodomain production constructs (ectodomain fused to hexahistidine and BirA ligase peptide substrate tags) were prepared by NotI/AscI restriction enzyme double digest (New England Biolabs) of pTT3-based vector backbones (50 ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lyophilized peptides were resuspended in 200 µl of 50 mM ammonium bicarbonate to which 3 µl of PNGaseF (New England Biolabs) were added for a 4h incubation at 37C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Plant Biology 2022Quote: ... a YFP sequence was inserted just after putative endoplasmic reticulum signal peptide sequences in LTPG1 and LTPG2 using the homologous recombination Gibson Assembly system (New England Biolabs), according to Kim et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... Coding sequences for mouse Gata4 and E2-Crimson preceded by an E2A self-cleaving peptide (E2A-E2-Crimson) were assembled using NEBuilder HiFi DNA assembly (NEB) to generate pCX-Gata4-E2A-E2-Crimson ...
-
bioRxiv - Cancer Biology 2023Quote: 20 μL of the lysate DNA containing the peptide library was PCR amplified with Q5 high-fidelity DNA polymerase (New England Biolabs), for 15 cycles in a 50 μL reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Immunology 2019Quote: ... activated and transduced T cells were incubated with GXR-B27 cells pulsed with the indicated peptide concentrations for 6 hours in presence of Brefeldin A (NEB; 420601). The cells were stained with anti-LNGFR-PE ...