Labshake search
Citations for New England Biolabs :
1 - 50 of 823 citations for PF 4 CXCL4 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2021Quote: ... All Pf-SUMO and Pf-Ubc9 mutants were generated using Q5 Site-Directed Mutagenesis kit (NEB #E0554S) in Pf-SUMO wild type backbone ...
-
bioRxiv - Plant Biology 2021Quote: Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Neuroscience 2023Quote: Codon-optimized human TDP-43-His LIC-A constructs were transformed into T7 express (New England Biolabs, #C3029J) E ...
-
bioRxiv - Cancer Biology 2020Quote: ... with Hi-Fi DNA builder (NEB). Primers used to amplify specific regions are described in (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... burgdorferi B31-A cells using primers PF MBP0058_BamHI (CGTCGACGGATCCGATACTACAGCATTAGGACATTATC) and PR MBP0058_PstI (TTAATTACCTGCAGTTATCTTTTTATAAGCACAGTGGCTC) (restriction sites are underlined) and cloned into the pMAL c5x (NEB Inc.) using BamHI and PstI restriction sites to produce the MBP-BB0058 protein ...
-
bioRxiv - Molecular Biology 2020Quote: ... Exchange of V5/His to myc/His was performed using the Q5 site-directed mutagenesis kit (NEB #E0554) according to the manufacturer’s protocol resulting in pEF1-ZAP-S-myc/His and pEF1-ZAP-L-myc/His ...
-
bioRxiv - Biophysics 2022Quote: ... 2018) and a C-terminal 6x His tag and cloned into the pET21B vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biophysics 2022Quote: ... The DNA fragment was amplified by PCR by inserting a C-terminal 6x His tag and cloned into the pETDUET-1 vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biochemistry 2021Quote: ... 25 U Hi-T7 RNA polymerase (NEB #M0658), 250 nM RNaseAlert™ QC System v2 (ThermoFisher ...
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 DNA was extracted and amplified by Q5 High-Fidelity PCR (NEB, M0494S) using primers encompassing the sgRNA recognition site ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was cut with Hind III and Bam HI (NEB) for 1h at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... and His-MBP-ZFC3H1 onto an Amylose resin (NEB). After extensive washing ...
-
bioRxiv - Immunology 2021Quote: ... were assembled using Hi-Fi DNA Assembly Mix (NEB). For the SFFV-Cas9 vector ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10µg/ml) and apyrase (25mU/ml, NEB); the suspension was incubated for 1h at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Hi-Fi assembly from New England BioLabs (NEB) and other basic molecular cloning approaches ...
-
bioRxiv - Genomics 2021Quote: ... was then inserted by Hi-Fi assembly (NEB, E2621) using 0.025 pmols of vector and 0.05 pmols of the GFP amplicon ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEB Hi-Fi assembly mix (New England Biolabs). A mixture of the two guide plasmids (each at 100ng/µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... We expressed the His-SUGCT in Lemo cells (NEB), inoculating 4L of TB with 4 mL overnight culture ...
-
bioRxiv - Microbiology 2019Quote: ... or Bam HI and Xho I (New England BioLabs, MA). The column isolated DNA fragments were ligated into our modified pFastBac1 plasmid having 6xHis tag at C-terminus ...
-
bioRxiv - Molecular Biology 2020Quote: ... and amplified via PCR with NEBNext Hi-fidelity enzyme (NEB). The resulting next-generation sequencing libraries were sequenced on a HiSeq2500 (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... Followed by subcloning the PCR amplicon in Bam-HI (NEB) restriction digested pCW57-tGFP-2A-MCS plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEBuilder Hi-Fi Assembly (New England Biolabs, Cat. #E2621). The pMB1052 construct was subsequently cut using BspDI and EcoRV (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... and amplified via PCR with NEBNext Hi-fidelity enzyme (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... The Hi-Scribe T7 High Yield RNA synthesis kit (NEB) was used to generate RNA transcripts at 37°C for 16 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... using the NEBuilder Hi-Fi Assembly kit (New England Biolabs). To ensure representation of all variants in the population ...
-
bioRxiv - Cancer Biology 2023Quote: ... cut with hi-fidelity EcoRI and BamHI (New England Biolabs), and gel purified ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The two fragments were assembled using HI-FI assembly (NEB E5520S). To construct the Prcan-1-R1∷mCherry and Prcan-1-R2∷mCherry plasmids ...
-
bioRxiv - Immunology 2021Quote: ... The fragments were assembled using Hi-Fi DNA Assembly Mix (NEB). For the DonorgRNA vector ...
-
bioRxiv - Genomics 2021Quote: ... and 25 µl 2x NEBNext Hi-Fi PCR mix (NEB, USA) per reaction ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10 μg/mL) and apyrase (25 mU/mL, NEB); the suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Nb35–His (10 µg/ml) and apyrase (25 mU/ml, NEB). The suspension was incubated for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: His-MBP-Fbp17SH3 was precipitated by amylose beads (NEB; cat#E8021L). After purification ...
-
bioRxiv - Plant Biology 2022Quote: ... and MBP-HIS-GFP proteins were purified with amylose resin (NEB) and SUMO-HIS-BIN2 protein was purified with Ni-NTA Agarose (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... For all Gibson Assemblies the NEB Hi-Fi Assembly Mastermix (NEB) was used ...
-
bioRxiv - Genetics 2023Quote: ... To facilitate homology directed assembly (Gibson or NEB Hi Fi assembly), 30bp homology with the preferred SEED cassettes were included at each site of the BsaI sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... For his purpose pEKEx2 was first linearized using SacI (NEB, USA). The gene for mCherry was amplified by PCR using the primer pairs low_mCherry_fw and low_mCherry_rev (Table S1 ...
-
bioRxiv - Biophysics 2021Quote: An in-frame fusion between the human 5-HT5AR from the Presto-Tango cDNA library (4) and the human Gαi1 was made via HiFi DNA assembly (New England Biolabs, Ipswich, MA). Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene ...
-
bioRxiv - Genetics 2019Quote: ... Hi-C DNA was amplified using Index Primers set 1 (NEB, E7335S). The Hi-C libraries were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... and the fragment was assembled using Hi-Fi DNA Assembly Mix (NEB) into the donor vector pADN171XS7 ...
-
bioRxiv - Microbiology 2021Quote: ... His-MBP-MirA were first isolated using amylose bead affinity chromatography (NEB) in conditions specified by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... The homology plasmids were assembled using HI-Fi DNA Assembly Mastermix (NEB) with four PCR-generated DNA fragments (see Table S2 for primers) ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified and then cleaved with Xho I and Bam HI (both NEB). After further purification ...
-
bioRxiv - Microbiology 2021Quote: ... Then the His-tag was cleaved by incubation with TEV protease (NEB) for 18 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... and then ligated by Hi-Fi DNA assembly (New England Biolabs Inc.). Irgb6-WT and Irgb6-T95D were expressed and purified as described (Saijo-Hamano et ...
-
bioRxiv - Biochemistry 2023Quote: ... was cloned into pUC19 by Gibson cloning (Hi-Fi cloning system, NEB) to replace the yeast sequence:
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs). Regularly ...