Labshake search
Citations for New England Biolabs :
1 - 50 of 257 citations for PD L1 Human HEK293 Flag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Immunology 2023Quote: All PD-1 mutants were generated using Q5 site-directed mutagenesis kit (NEB) following the manufacture’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 DNA was extracted and amplified by Q5 High-Fidelity PCR (NEB, M0494S) using primers encompassing the sgRNA recognition site ...
-
bioRxiv - Genomics 2023Quote: ... L1 - Adaptor.L8 with Adaptor.S (21)) was annealed with the DNA fragments by T4 DNA ligase (New England Biolabs) incubating overnight at 16 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... the pcDNA3.1 Flag-mRBPJ A284V CRr and the pcDNA3.1 Flag-mRBPJ F261A/A284V CRr were digested with NotI (NEB) and the cDNAs were inserted into the pMY-Bio IRES Blasticidin pre-digested with NotI (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... σA-FLAG and RbpA-FLAG proteins were prepared by PCR using Q5® High-Fidelity DNA Polymerase (NEB) with primers #3130 + #3131 (HelD) ...
-
bioRxiv - Developmental Biology 2022Quote: ... EGFP-FLAG was removed using BamHI (NEB) and NotI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-ATP6V1H(Δ176-191)-FLAG and pcDNA3.1-ATP6V1H(Δ176-193)-FLAG were generated using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). pENTR-ATP6V1H-FLAG was produced using the pENTR/D-TOPO Cloning Kit (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Nsp1 and 2 genes were cloned into pENTR (L1-L2) using Hifi DNA Assembly (New England Biolabs, Ipswich, MA, USA). LR recombination Gateway (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Full-length L1s were then reconstructed by combining PCR-mutation free fragments from different clones using restriction enzymes (New England Biolabs) recognizing the L1 sequence ...
-
bioRxiv - Genetics 2022Quote: ... L1 elements were then reconstructed by combination of non-mutated fragments from different clones using restriction enzymes (New England Biolabs) cutting within the L1 sequence.
-
bioRxiv - Molecular Biology 2020Quote: ... Bisulfate-treated DNA served as the template in one round (L1-Gf and L1-A) or two nested rounds (H19 and IAP) of PCR with EipMark Hot Start Taq DNA Polymerase (NEB) using the following protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... FLAG-LC3B-K51R and FLAG-BIRC6-C4597A were generated using Q5® Site-Directed Mutagenesis Kit (New England Biolabs, E0552). The pSuper-Birc6-shRNA plasmid was generated by cloning shRNA for rat Birc6 (5’-CACCCCAGTAGTCATACCA-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3-FLAG-PKCα constructs expressing FLAG-tagged PKCα were generated by amplifying the coding region of PKCα from HeLa Tet-off cell total RNA and inserting it into pcDNA3-FLAG (45) immediately downstream of the FLAG peptide sequence using Gibson Assembly (NEB). Constitutive active PKCα-AE was generated by mutating alanine 25 into glutamic acid ...
-
bioRxiv - Biochemistry 2023Quote: ... Bleo-treated WT-PNKP-FLAG and K226R-PNKP-FLAG cells using 10 μg of custom-made rabbit polyclonal anti-AcK226 Abs (Ez Biolabs). All other subsequent steps and buffers used for IP were the same as described earlier (17,18) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the TIGAR-FLAG sequence from pGenLenti-TIGAR-FLAG was PCR amplified using Q5 High Fidelity DNA Polymerase (New England Biolabs) and was cloned into PCW57.1 at the 5’ BSRGI and 3’ BAMHI restriction sites using NEBuilder HIFI DNA Master Mix (New England BioLabs).
-
bioRxiv - Molecular Biology 2023Quote: ... zHmgn2 CDS-FLAG and oHmgn2 CDS-FLAG were cloned into a pCS2 vector using NEBuilder HiFi DNA Assembly (New England Biolabs). The mRNAs for these constructs were synthesized from linearized plasmids using the mMessage mMachine SP6 Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... were subcloned into phCMV3 to express C-terminal FLAG-tagged CatSper subunits (phCMV3-CatSperd or z-Flag) using NEBuilder® HiFi DNA Assembly Kit (NEB). A stop codon was placed at the upstream of HA-encoding sequences of phCMV3 vector for FLAG-tagged CatSper subunit cloning.
-
bioRxiv - Genomics 2021Quote: ... and introduced between XhoI and BamHI sites in c-Flag pcDNA3 (addgene #20011) to generate Flag-tagged hPEX5 using NEBuilder® HiFi DNA assembly Master mix (New England Biolabs). Site-directed mutagenesis for amino acid substitution was performed using the Q5® Site-directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... These two combined samples were ethanol precipitated and used to generate male and female L1 small RNA libraries using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs, MA, USA). Indexed libraries were size selected for sRNAs (<150nt ...
-
DDK regulates replication initiation by controlling the multiplicity of Cdc45-GINS binding to Mcm2-7bioRxiv - Cell Biology 2020Quote: ... the FLAG eluate was labeled with SNAP-Surface549 (NEB) by incubating 3x molar excess of dye at 4°C overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... PTEN and PD-1 were subcloned into linearized pLJM1-empty vector using EcoR1 and NHE1 restriction enzymes (NEB) and Takara’s two-step In-Fusion® snap assembly (#638948 ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs). Regularly ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Cat. #E7770) or NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (#E7760) ...
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...
-
bioRxiv - Genetics 2022Quote: ... the sgRNA sequences were inserted into the pBSMVγPDS plasmid after removing the PDS fragment by PacI and NotI digestion (New England BioLabs, Ipswich ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Genetics 2019Quote: ... Flag-Mad-8 was generated by PCR followed by Gibson assembly (NEB) and the S359L substitution was verified by sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... DmMIC10b(C64S)-FLAG were produced using the Site-Directed Mutagenesis Kit (NEB) and the oligonucleotides given below.
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Genetics 2019Quote: ... The 3′-UTR sequences of both genes were then amplified from genomic DNA obtained from HEK293 cells with Phusion® High-Fidelity DNA Polymerases (NEB, Ipswich, MA) and cloned into the multiple cloning site of the pMIR-REPORT luciferase miRNA expression vector (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... RACK1-FLAG expression construct was PCR-amplified from cDNA with Phusion polymerase (NEB) with primers CACCATGACTGAGCAGATGACCCTTCGTG TTATCACTTATCGTCGTCATCCTTGTAATCGCGTGTGCCAATGGTCACCTGC CAC and cloned into pENTR D-TOPO vector ...
-
bioRxiv - Cell Biology 2021Quote: Myc- and DDK (FLAG)-tagged Hemopexin mRNA was transcribed from an AgeI (NEB) linearised plasmid using T7 RNA polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: ... by insertion of a second Flag using Gibson assembly (New England BioLabs, E5510S). The legK1 coding sequence was then inserted from pENTR/D-TOPO-LegK1 into p2xFlag through the GATEWAY technology ...
-
bioRxiv - Molecular Biology 2023Quote: pAC8-FLAG-SHLD3 truncation plasmids were generated using Gibson cloning (New England Biolabs) and a pAC8-FLAG-SHLD3 template (Setiaputra et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Cell Biology 2022Quote: ... Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B, P6010, NEB) with or without 1 mM CX4549 (S2248 ...
-
bioRxiv - Biophysics 2021Quote: MukF Flag-tagged fragments were expressed from pET 21 plasmids in C3013I cells (NEB).The Flag-tagged MukE and MuF were at the C-terminus ...
-
bioRxiv - Cell Biology 2022Quote: ... FLAG-MBOAT7 was cloned into the lentiviral vector pRH115-mCherry linearized with XbaI (NEB) and BamHI (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... and ligated into pcDNA5/FRT/TO-N-FLAG-BirA* using Quick Ligation Kit (NEB). Top10 competent E ...
-
bioRxiv - Microbiology 2019Quote: ... falciparum and human histones (New England Biolabs) (6µg) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 U RNase Inhibitor Human Placenta (NEB), 50 pmol Oligo d(T)23 (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Human CK2 was obtained from NEB (P6010S). IE2-NTD was phosphorylated in buffer provided by the manufacturer which contains 50mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... was replaced with sequence for a 3×FLAG tag by Gibson Assembly (New England Biolabs) to create payload plasmid pSAB41 ...