Labshake search
Citations for New England Biolabs :
301 - 350 of 10000+ citations for Oxytocin ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Plant Biology 2020Quote: ... A total of 12 sRNA libraries were constructed from 5 μg of size-selected RNA using the NEBNext® Small RNA Library Prep kit (New England Biolabs, Ipswich, MA, USA) as per the manufacturers’ instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Klenow 3’ to 5’ exo (NEB: M0212) and Biotin-11-dUTP (40 μM ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 1 μl 5′ deadenylase (New England Biolabs) and 1 μl RNaseOUT ...
-
bioRxiv - Microbiology 2020Quote: ... 5 Us of exo(-) Klenow Fragment (NEB), 200 pmol of NNSR-2 Primer for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 5 μl Large (Klenow) fragment (NEB) to the DNA at R.T ...
-
bioRxiv - Immunology 2022Quote: ... containing 5 U murine RNase Inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 units of restriction enzyme BsaJI (NEB) was directly mixed with 300ng of DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5× Q5 High GC Enhancer (NEB). PCR thermocycling conditions were 98 °C during 5 s ...
-
bioRxiv - Genetics 2022Quote: ... with Klenow fragment (3’-5’ exo-; NEB). Hybridization signals were obtained using Typhoon FLA 7000 (GE Healthcare ...
-
bioRxiv - Microbiology 2022Quote: ... m7G(5’)G RNA Cap Analog (NEB) or Anti-Reverse Cap Analogue (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 U M-MuLV RT (NEB) in RT Buffer (25 mM KCl ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 U of Exonuclease I (ExoI, NEB) were added to the PCR mix and incubated at 37 °C for 30 minutes ...
-
bioRxiv - Genetics 2021Quote: ... and 5 μl Murine RNase Inhibitor (NEB). Worm lysate was cleared by centrifugation at 20,000 × g for 20 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... To supernatant 5 μl 10x CutSmart (NEB) was added and incubated with 20 units ExoI nuclease (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 polynucleotide kinase (NEB), and 25 μL of DEPC H2O and incubating at 25 °C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 DNA polymerase (NEB), 1 μL of Klenow DNA polymerase (NEB) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 7.5U Klenow 3’-5’ exo minus (NEB) were incubated for 30 min at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl 10X CutSmart buffer (NEB B7204S) and 0.5 µl BbsI or BsaI_HFv2 (the enzyme used for the cloning reaction) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 mM sodium orthovanadate (New England Biolabs), and 10 mM sodium fluoride (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl of Gibson assembly mastermix (NEB) and dH2O up to 10 µl were mixed and incubated at 50°C for 1 h ...