Labshake search
Citations for New England Biolabs :
301 - 350 of 3537 citations for OX7 Anti Thy 1 Mouse Monoclonal biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were then incubated for 1 hour with anti-MBP antibody (New England BioLabs) solution diluted in calcium containing blocking buffer ...
-
bioRxiv - Microbiology 2022Quote: ... the membranes were hybridized overnight with antisense oligo probes listed in the S6 Table end-labeled with T4-PNK (New England Biolabs) using 32P-γ-ATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SNAP-tagged histones neosynthesized during the chase time were pulse-labeled by incubating cells with 2 μM of red-fluorescent SNAP reagent (SNAPcell TMR star, New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE, NEB) in the presence of GTP and S-adenosylmethionine (SAM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Microbiology 2021Quote: ... was dephosphorylated and 5’ end labeled with P32 as follows: 25 pmol of RNA was dephosphorylated using 50U of Antarctic Phosphatase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the strands of each sequence was then labeled with P32 as follows: 10 pmols of single stranded DNA was incubated with 5 Units of T4 PNK (NEB) and 0.64µCi of P32- γ -ATP (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-protein complexes were radioactively labeled with 32P-γ-ATP (20 μCi) using 40U T4 Polynucleotide Kinase (New England Biolabs) in supplied PNK buffer for 30 min at 37ºC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... pJET1.2 plasmids containing 150 bp FCR monomer sequences were PCR-amplified and fluorescently labeled using random hexamer priming and Klenow (exo-) polymerase (New England Biolabs). Both Alexa Fluor 488 and 568 dUTP-conjugated fluorophores were used ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Immunology 2020Quote: ... A 32P-labeled 368 nt transcript was generated from EcoRI digested probe temple (described below) using T7 RNA polymerase (New England Biolabs). The probe was diluted in the hybridization buffer described above ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 pmol of oligonucleotide was labeled at the 5’ terminus with 0.05 mCi [γ-32P]-ATP using T4 Polynucleotide Kinase (New England Biolabs). For annealing ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 20picomoles of CIP treated RNA was 5’ end labeled with 50μCi of [γ-32P] ATP (10mCi/ mL, BRIT, India) by incubating with T4 polynucleotide kinase (New England Biolabs) at 37°C for 35 min ...
-
bioRxiv - Zoology 2020Quote: ... Each gel also contained 32P-end-labeled size ladders (Molecular Weigh Marker XV, by Roche Diagnostics and 1Kb DNA ladder by New England Biolabs). After electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... tRF-5s, itRFs were end-labeled with 32P-ATP (Board of Radiation and Isotope Technology, India) using polynucleotide kinase (NEB), purified through MicroSpin G-25 Columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa-CENP-A-SNAP cells were grown in 6 well plates and pulse labeled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4µM final concentration ...
-
bioRxiv - Biochemistry 2022Quote: ... a tolerant position was mutated to facilitate making a labeled LexA variant.56 The His-LexA W201C mutant was generated using a Q5 Site-Directed Mutagenesis Kit (NEB) and the mutation was confirmed via sequencing ...
-
bioRxiv - Genomics 2022Quote: ... Two 500 ng reaction tubes of DLE1-labeled DNA were each mixed with 4 μL of 10X CutSmart buffer (New England Biolabs), 60 μM of lab-made synthetic AdoYnATTO643 (see synthesis in the Supplementary Data) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The products were analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel against a 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) and quantitated with a phosphorimager (Typhoon FLA 9500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed by electrophoresis in a non-denaturing 12% polyacrylamide gel with 5’-labeled Low Molecular Weight DNA Ladder (New England Biolabs) run in a parallel lane ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 200 µL of phosphate saline buffer (PBS) and labeled by incubation with SNAP-cell TMR-Star (New England Biolabs) for 30 min at 37°C in the dark at a final concentration of 250 nM ...
-
bioRxiv - Microbiology 2023Quote: ... and oligonucleotides crp500F and crp500R (one of which was labeled with [γ32P]ATP by use of T4 polynucleotide kinase (NEB)) ...
-
bioRxiv - Microbiology 2023Quote: ... and FAM-labeled TaqMan probe were used in viral negative strand quantification with Luna Universal Probe qPCR Master Mix (New England Biolabs). The reactions were run under the cycling conditions as follows ...
-
bioRxiv - Biochemistry 2023Quote: Both native and modified oligonucleotides were 5’-32P labeled by [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs) following manufactures recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: Total SNAP-tagged histones were labeled by incubating cells with 2 µM of the red-fluorescent reagent SNAP-cell TMR-star (New England Biolabs) for 15 min before cell fixation ...
-
bioRxiv - Biochemistry 2023Quote: ... The oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted as described above with the addition of a second in vitro transcribed 4sU-labeled (10% of UTP was exchanged for 4sUTP in the T7 RNA polymerase in vitro reaction (NEB)) spike-in ERCC-00136 ...
-
bioRxiv - Microbiology 2023Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ- 32P]-ATP (150 µCi) ...
-
bioRxiv - Genomics 2024Quote: ... Two 500 ng reaction tubes of DLE1-labeled DNA were each mixed with 4 µL of 10X CutSmart buffer (New England Biolabs), 60 µM of lab-made synthetic AdoYnATTO643 (Margalit et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Molecular Biology 2024Quote: ... Oligos (20 pmoles) were labeled at their 5’ ends using gamma-32P-rATP (3000 Ci/mmole) and polynucleotide kinase (New England Biolabs), and purified on 7M urea ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicons were end-labeled with [γ-32P] dATP (Perkin-Elmer) in the presence of T4 polynucleotide kinase (New England BioLabs), after which they were centrifuged through a TE Select-D G-25 spin column (Roche Applied Science ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were complimentary to the 3′-UTR regions immediately adjacent to the poly(A) tails and were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 200 ng of the purified amplicon were end-labeled using 10 µCi of γ-32P ATP (Amersham) and T4 polynucleotide kinase (NEB). The labeling reaction was then desalted on a G-25 spin column and further precipitated with 70% ethanol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The single-stranded labeled probes were finally cleaned up using the Monarch PCR & DNA cleanup kit (New England Biolabs®, T1030) following the oligonucleotide cleanup protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 32P were then labeled to 5’ end of digested RNA by T4 Polynucleotide Kinase (PNK) (New England Biolabs, Cat. No. M0201S). After labelling ...
-
bioRxiv - Genetics 2022Quote: ... Specific sRNAs were detected by hybridization with DNA oligonucleotides labeled at their 5’ termini with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Ibrahim et al. ...
-
bioRxiv - Developmental Biology 2020Quote: A digoxin-labeled human H19X probe was transcribed in situ from a linear template plasmid by T7 RNA polymerase (NEB, UK) with Digoxin-labeled Uridine (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... The odf3l2a template was amplified from total RNA with T3 and T7 sites on the forward and reverse primers respectively and the DIG-labeled antisense probe was synthesized directly from purified PCR product using T7 RNA polymerase (NEB M0251S). The ankef1a and saxo2 probe templates were amplified from total RNA with gene specific primers and cloned into the pCR4-TOPO vector (Thermo Fisher 450071) ...
-
bioRxiv - Biochemistry 2023Quote: ... oligonucleotide X12-3 HJ3 (93 nt) was labeled at the 5’ terminus with [γ-32P] (Hartmann-Analytic) and T4 polynucleotide kinase (New England Biolabs), according to standard protocols65 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA probes complementary to the sequence of each sRNA were end-labeled with [μ-32P]dATP (Perkin-Elmer) and T4 polynucleotide kinase (New England BioLabs) as described before (28 ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Biochemistry 2023Quote: ... The indicated oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA oligonucleotides complementary to miRNA sequences were end-labeled with γ-32P-ATP using T4 PNK (New England Biolabs, Beverly, MA).
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...