Labshake search
Citations for New England Biolabs :
151 - 200 of 234 citations for Neuromedin S Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: DNA molecules were prepared by digestion of plasmid pSupercos lambda 1,2 (provided by S. Hage, Delft University of Technology, Delft, The Netherlands) with XhoI (New England Biolabs) as described previously(18) ...
-
bioRxiv - Developmental Biology 2024Quote: ... a mix containing 18µM sgRNA and 12µM Cas9 protein (EnGen™ Spy Cas9-NLS S. pyogenes, NEB Cat# M0646T) was incubated for 10 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... 3000 ng of high molecular weight DNA was prepared by blocking available DNA ends with calf intestinal phosphatase (NEB Cat #M0525). DNA and dA-tails on all available DNA ends were cleaved by RNPs and Taq polymerase (New England Biosciences Cat #M0273 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Cell Biology 2024Quote: ... Thymidine was then removed by washing cells with culture media and blocking of existing CENP-A was performed by treatment with 10 mM SNAP-Cell® Block BTP (S9106S, NEB) for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... We first joined sequences for fluorescent protein mCerulean (CFP) and 2A peptide P2A (a ribosomal skip sequence) with Q5 (NEB) fusion PCR and added them to the pWPXL vector with Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Bioengineering 2020Quote: ... Respective peptide DNA coding sequences (CDS) were amplified from hACE2 via PCR and inserted using HiFi DNA Assembly Master Mix (NEB) for Gibson Assembly into the pcDNA3-SARS-CoV-2-S-RBD-Fc backbone linearized by digestion with NheI and BamHI ...
-
bioRxiv - Biochemistry 2022Quote: ... the sequence for the 50-residue hinge-region “C-peptide” (Ala317-Phe366) was removed via site directed mutagenesis (New England Biolabs). The construct further included the miniGs399 protein15 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3-FLAG-PKCα constructs expressing FLAG-tagged PKCα were generated by amplifying the coding region of PKCα from HeLa Tet-off cell total RNA and inserting it into pcDNA3-FLAG (45) immediately downstream of the FLAG peptide sequence using Gibson Assembly (NEB). Constitutive active PKCα-AE was generated by mutating alanine 25 into glutamic acid ...
-
bioRxiv - Developmental Biology 2022Quote: ... and zebrafish cachd1 ectodomain production constructs (ectodomain fused to hexahistidine and BirA ligase peptide substrate tags) were prepared by NotI/AscI restriction enzyme double digest (New England Biolabs) of pTT3-based vector backbones (50 ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lyophilized peptides were resuspended in 200 µl of 50 mM ammonium bicarbonate to which 3 µl of PNGaseF (New England Biolabs) were added for a 4h incubation at 37C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Plant Biology 2022Quote: ... a YFP sequence was inserted just after putative endoplasmic reticulum signal peptide sequences in LTPG1 and LTPG2 using the homologous recombination Gibson Assembly system (New England Biolabs), according to Kim et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... Coding sequences for mouse Gata4 and E2-Crimson preceded by an E2A self-cleaving peptide (E2A-E2-Crimson) were assembled using NEBuilder HiFi DNA assembly (NEB) to generate pCX-Gata4-E2A-E2-Crimson ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Cancer Biology 2023Quote: 20 μL of the lysate DNA containing the peptide library was PCR amplified with Q5 high-fidelity DNA polymerase (New England Biolabs), for 15 cycles in a 50 μL reaction ...
-
bioRxiv - Neuroscience 2021Quote: ... Donor plasmids for homology directed repair were generated by cloning homology arms from Canton-S genomic DNA with Phusion Hot Start DNA polymerase (New England Biolabs) and inserting them sequentially into the pHD-DsRed-attP vector using restriction enzymes 55 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Restriction digestions were performed in a 60 ml volume with 1200 ng of DNA and 4–4.5 ml restriction enzyme(s) (Chr1 hotspot pair: NsiI, NcoI, and BglII or NcoI alone; Chr19 hotspot pair: BamHI or KpnI; BioLabs). Reactions were incubated overnight at 37 °C followed by an additional 3 h of incubation with a 1.5–2 ml of fresh restriction enzyme(s) ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Universal PCR primer for Illumina (5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC-s-T-3’) and NEBNext Index primer for Illumina (NEB, index# 9-13 for five libraries in each repeat) ...
-
bioRxiv - Physiology 2020Quote: ... and the Esp3I fragment of the pPVxRF3 vector (a gift from S. Kondo) containing Venus and 3xP3-dsRed-Express2 using NEBuilder HiFi DNA Assembly Master Mix (NEB). The combined fragment was cloned into pBluescript ...
-
bioRxiv - Genomics 2021Quote: ... Methylation reactions were performed in a 100uL reaction containing 1X CutSmart Buffer and 1mM S-adenosyl-methionine (SAM, New England Biolabs) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... The D614G S-protein was generated by introducing the mutation into the Wuhan reference strain via Q5 Site-directed mutagenesis (NEB). Other individual mutations were subsequently introduced into the D614G S by the same process ...
-
bioRxiv - Biochemistry 2020Quote: Deglycosylation of S protein from the lysate of HEK293 cells transfected with pTwist-EF1a-nCoV-2019-S-2xStrep plasmid was performed as described previously [35] using PNGase F (New England Biolabs).
-
bioRxiv - Immunology 2021Quote: ... pSFG-SARS-CoV-2 S D614G was cloned from pSFG-SARS-CoV-2 S plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). 293T cells were transfected with 3.75 μg pSFG-SARS-CoV-2 S or pSFG-SARS-CoV-2 S D614G ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... pDWV-S-GFP and the parental pDWV-304 were produced using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: SARS-CoV-2 S N501Y plasmid was obtained from SARS-CoV-2 S plasmid (HDM-IDTSpike-fixK) by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, New England Biolabs). SARS-CoV-2 S and SARS_CoV-2 S N501Y pseudotyped retroviral particles were produced in HEK293T cells as described previously (29) ...
-
bioRxiv - Bioengineering 2022Quote: ... In vitro Cas9 cleavage assay was carried out using purified IVT product and Cas9 protein (Cas9 Nuclease, S. pyogenes, New England BioLabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Capillary tubes (0.025⍰mm inner diameter) were filled with either 0.5⍰mM hemin or 0.5⍰mM S-adenosylmethionine (SAM) (New England Biolabs, Ipswich, MA) in the motility buffer and sealed with vacuum silicone grease (Dow Corning ...
-
bioRxiv - Biochemistry 2022Quote: ... accordingly to manufacturer’s instructions and 1 μg of RNA was reverse-transcribed into cDNA using M-MuLV reverse transcriptase (New England Biolabs) and random hexamers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2020Quote: ... Reactions were performed in a 200uL reaction with 1X CutSmart Buffer and 1mM S-adenosyl-methionine (SAM, New England Biolabs) and incubated with 2.5uL enzyme at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: The SARS2-CoV-2 vaccine candidates were cloned by combining the S cDNA (obtained after PCR on overlapping synthetic cDNA fragments; IDT) by a NEB Builder Cloning kit (New England Biolabs) into the pShuttle-YF17D backbone ...
-
bioRxiv - Genomics 2020Quote: ... Methylation reactions were performed in a 100 uL reaction with Methylation Reaction buffer (1X CutSmart Buffer,1 mM S-adenosyl-methionine (SAM, New England Biolabs)) and incubated with 2.5 uL EcoGII at 37°C for 30 minutes ...
-
The plant pathogen Pectobacterium atrosepticum contains a functional formate hydrogenlyase-2 complexbioRxiv - Microbiology 2019Quote: ... of the target gene(s) was amplified and inserted into pKNG101 using a three fragment Gibson assembly reaction (HiFi Assembly, NEB). For the insertion of a deca-His encoding sequence into hyfG ...
-
bioRxiv - Physiology 2021Quote: ... and the Esp3I fragment of the pPVxRF3 vector (a gift from S. Kondo) containing Venus and 3xP3-dsRed-Express2 using NEBuilder HiFi DNA Assembly Master Mix (NEB). The combined fragment was cloned into pBluescript ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Genomics 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2022Quote: ... Dam activity was induced by resuspension in 100 μL DigWash supplemented with 80 μM S-adenosyl-methionine (SAM) (NEB, B9003S) and incubated at 37 °C for 30 minutes ...
-
bioRxiv - Bioengineering 2022Quote: 200 nM of isolated smgRNA were injected in a pre-incubating solution of 200 nM Cas9 (S. pyogenes, NEB, M0386), 120 nM fluorescent beacon and 1 U.μL-1 murine RNase Inhibitor (NEB M0314 ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... by incubating the DNA construct (1 μg) with 4 units of SssI methylase and 160 μM S-adenosylmethionine (New England Biolabs) for 4 h at 37°C or mock-methylating by incubating in the absence of S-adenosylmethionine ...
-
bioRxiv - Plant Biology 2023Quote: ... At least 50 μg of total RNA was randomly fragmented for 125 s at 90°C to approximately 200 nt using the NEBNext Magnesium RNA Fragmentation Module (New England Biolabs). Fragmented RNA was precipitated with 4 μl of GlycoBlue (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... Mutagenic PCR constructs were generated by amplifying the upstream and downstream DNA fragments flanking the gene(s) of interest followed by fusion of these fragments with the Janus Cassette using a HiFi assembly master mix (NEB). Transformation of TIGR4 with the mutagenic construct (100ng/ml ...
-
bioRxiv - Microbiology 2023Quote: ... concisus for 2 h at 37°C in presence of 0.4 mM S-Adenosylmethionine (SAM, New England Biolabs, Ipswich, MA). After methylation ...
-
bioRxiv - Biochemistry 2023Quote: ... The same construct containing a blasticidin-S deaminase (BSD) gene in place of PAC was generated by Gibson assembly (NEB) using primers ZJ1-ZJ4 (Table S2) ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR fragment was gel purified and inserted into plasmids pTRC99a and pKI_IS10 (gift of S. Wenk) using HiFi DNA Assembly Cloning Kit (NEB. pZE21) for Gibson cloning ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...