Labshake search
Citations for New England Biolabs :
1 - 50 of 173 citations for Nestin NES Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... truncated KQ (NE Biolabs, M0373S) at 16°C overnight ...
-
bioRxiv - Zoology 2021Quote: ... 200 μM of dNTPs (NE Biolabs), and 2 μl of DNA extract ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-ubiquityl-PCNA (Lys164) (NE Biolabs 13439S) (1:1000) ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of Taq polymerase (NE Biolabs), 0.5 µl of DNA template and 20.7 µl sterile nano pure water ...
-
bioRxiv - Neuroscience 2019Quote: ... MBP-TrkB-454-821 was coupled to amylose resin (NE BioLabs) and incubated in the presence of 10x molar access of either TAT-SIPA1L2 or TAT-Scr peptides with 1 µg of GST-SIPA1L2-1-624 fusion protein @4°C overnight ...
-
bioRxiv - Cancer Biology 2019Quote: ... rescued with the KM13 helper phage (New England Biolabs, Omaha, NE), and used for two other rounds of selection ...
-
bioRxiv - Developmental Biology 2023Quote: ... A repair plasmid was made using NE Builder (New England Biolabs) that includes a 430bp gypsy insulator sequence (Geyer and Corces 1992 ...
-
bioRxiv - Cancer Biology 2024Quote: ... hold) in the presence of NE Buffer 2.1 (B7202S, New England BioLabs) to form a double strand with EcoRI and AgeI sticky ends ...
-
bioRxiv - Microbiology 2022Quote: ... and tagged for multiplexing via the NE Next Multiplex Oligos for Illumina (NEB).
-
bioRxiv - Biophysics 2023Quote: ... The left lane (“L”) has a DNA size ladder (1 kb+, NE Biolabs). The black arrow in the left lane (“P” ...
-
bioRxiv - Biophysics 2023Quote: ... Samples used in RNA titrations additionally contained a Murine RNAse inhibitor (NE Biolabs) at a concentration of 1 unit/μL ...
-
bioRxiv - Microbiology 2022Quote: ... Q5 polymerase and modification enzymes were used according to the manufacturer’s instructions (NE Biolabs). The DNA was visualized with ethidium bromide (1 μg/ml) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The seminiferous tubules were washed twice with 1 U DNAse (NE Biolabs, Ipswich, MA) in PBS ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 100 ng P300core were mixed with NE Builder HiFi DNA Assembly Master Mix (Cat # E2623, NEB) and incubated at 50°C in thermal cycler for 1h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription of RNA using ProtoScript II First Strand cDNA synthesis kit (New England BioLabs, NE, E6560L) following the manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and NES constructs were generated by Q5 site-directed mutagenesis according to manufacturer instructions (New England Biolabs). All constructs were sequence validated by Sanger sequencing or Plasmidsaurus Oxford Nanopore sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs) using manufacturers protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 µg of Intein-RapGAP-SIPA1L2 (470-838) and Intein-Caldendrin were immobilized on chitin resin (NE BioLabs). Resin was washed with TBS buffer (150 mM NaCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10uM Illumina compatible forward and reverse PCR primers were added together with Q5 master mix (NE Biolabs, M0544S) followed by Ampure XP purification with 1:1 ratio ...
-
bioRxiv - Microbiology 2022Quote: ... histolytica RNA was prepared using the Monarch Total RNA Miniprep Kit (NEW ENGLAND BioLabs, Ornat, Nes Ziona, Israel). According to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA libraries ligated with the Illumina suitable adaptor sequences were generated and amplified with Q5 DNA polymerase (NE Biolabs). After purification from dimers by size selection in the agarose gel the libraries were sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: Site-directed mutagenesis of NES and hydrophobic-stretch coding sequences was performed using the Q5 site-directed mutagenesis kit (New England Biolabs) with either pCPLJJ50 ...
-
bioRxiv - Biochemistry 2019Quote: ... and cloned into a modified pOEM vector as HRV 3C-cleavable N-terminal GST fusion construct (GST-C1-GFP-NES) using the restriction enzymes NotI and AscI (NEB).
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 200 ng of purified PCR product were denatured and re-annealed in NE Buffer 2 (New England BioLabs, Cat. # B7002S). T7 endonuclease 1 (New England BioLabs ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids to express Flag-tagged and HA-tagged proteins were created by changing the Myc-coding sequence in pCMV-Myc expression plasmids to intended tag-coding sequence using inverse PCR and NE Builder HiFi Assembly (New England BioLabs), respectively.
-
bioRxiv - Plant Biology 2023Quote: ... and targeted to either the cytosol-only (CPK17G2A-NES-YA) or nucleus-only (NLS-YA) (Mehlmer et al., 2012) were amplified with Q5 DNA polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 25uM RibOxi RT primer was then annealed to the reaction before ligation of 5’ RNA linker using T4 RNA ligase I at room temperature for 1 hour and subsequent reverse-transcription using Protoscript II (NE Biolabs, M0368S). cDNA was then purified with AmpureXP beads with 1:1.8 ratio ...
-
bioRxiv - Cancer Biology 2023Quote: ... that was used to prepare RNA sequencing libraries with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NE Biolabs). Actinomycin D was used for first strand cDNA synthesis ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 μg RNA was used to isolate poly(A)-enriched RNA with NEBNext® Poly(A) mRNA Magnetic Isolation Module (NE Biolabs, Ipswich, MA) that was used to prepare RNA sequencing libraries with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NE Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).
-
bioRxiv - Cancer Biology 2019Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibody (New England BioLabs). An InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibodies (New England BioLabs), and analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Kcr antibody (PTM Biolabs, PTM502), anti-Ub antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bound antibodies were detected by incubation with anti-rabbit DyLight 800-conjugated secondary antibody (New England BioLabs). Slides were analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Bound antibodies were detected by incubation with anti-rabbit DyLight 800-conjugated secondary antibody (New England BioLabs). Slides were analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Molecular Biology 2021Quote: Myc-Tag (9B11) antibody (NEB 2276 S) and mouse IgG (Santa Cruz sc-2025 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs), or mouse monoclonal anti-β-actin antibody (A5316 ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-butyryllysine antibody (PTM BioLabs, PTM#301) at 1:2000 dilution was incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies used were: New England Biolabs (NEB), Hitchin ...