Labshake search
Citations for New England Biolabs :
101 - 150 of 437 citations for NKG2A&CD94Heterodimer Human HEK293 His Flag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Hi-C single-index library preparation was performed as previously described56 using MboI (New England Biolabs) restriction enzyme.
-
bioRxiv - Microbiology 2023Quote: ... 750-basepair regions flanking each gene were amplified by PCR and Hi-Fi DNA Assembly (NEB) was used to clone into pExchange-tdk ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Microbiology 2024Quote: ... Tags (6x His or HA) were introduced using site-directed mutagenesis with KLD enzyme mix (NEB).
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Genetics 2019Quote: ... The 3′-UTR sequences of both genes were then amplified from genomic DNA obtained from HEK293 cells with Phusion® High-Fidelity DNA Polymerases (NEB, Ipswich, MA) and cloned into the multiple cloning site of the pMIR-REPORT luciferase miRNA expression vector (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... RACK1-FLAG expression construct was PCR-amplified from cDNA with Phusion polymerase (NEB) with primers CACCATGACTGAGCAGATGACCCTTCGTG TTATCACTTATCGTCGTCATCCTTGTAATCGCGTGTGCCAATGGTCACCTGC CAC and cloned into pENTR D-TOPO vector ...
-
bioRxiv - Cell Biology 2021Quote: Myc- and DDK (FLAG)-tagged Hemopexin mRNA was transcribed from an AgeI (NEB) linearised plasmid using T7 RNA polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: ... by insertion of a second Flag using Gibson assembly (New England BioLabs, E5510S). The legK1 coding sequence was then inserted from pENTR/D-TOPO-LegK1 into p2xFlag through the GATEWAY technology ...
-
bioRxiv - Molecular Biology 2023Quote: pAC8-FLAG-SHLD3 truncation plasmids were generated using Gibson cloning (New England Biolabs) and a pAC8-FLAG-SHLD3 template (Setiaputra et al. ...
-
bioRxiv - Evolutionary Biology 2020Quote: Purified DNA library (250 ng) was cut with the Hind III and Bam HI restriction enzymes (NEB) for 1h at 37 °C in a reaction mixture containing 1X of the NEB cut smart buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... pET17b-Kif5b(1-560)-GFP-His was transformed into BL-21[DE3]RIPL cells (New England Biolabs) until an optical density at 600 nm of 0.6-0.8 and expression was induced with 0.5 mM isopropyl-β-d-thiogalactoside (IPTG ...
-
bioRxiv - Genomics 2020Quote: ... We put the mutagenized genes in a pIVEX vector via Gibson assembly (NEB Hi-Fi DNA assembly) using 125ng of gene DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... and C-terminal additions) were assembled with the pcDNA5 backbone using Hi-Fi DNA assembly (NEB; E2621S).
-
bioRxiv - Plant Biology 2022Quote: ... His-TAD1 fusion proteins were purified according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA, USA). The bait protein GST-WL1 was incubated with GST beads (GE Healthcare ...
-
bioRxiv - Microbiology 2019Quote: ... the product was cloned into the pET1-5b N-terminal 6×His expression plasmid (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The His-GST tags were cleaved by incubating the pooled fractions with TEV protease (New England Biolabs) at 4°C for 16h ...
-
bioRxiv - Genetics 2019Quote: ... 2012) by removing cbr-Pmyo-2∷gfp∷his-72 UTR by cutting using KpnI and ApaI (NEB). The digested pZZ0031 backbone carrying cbr-unc-119(+ ...
-
bioRxiv - Bioengineering 2022Quote: ... The t-NLuc-His tag was double-digested with NdeI and XhoI restriction enzymes (New England BioLabs), and the RNA sensor region were digested with SgrAI and SacII restriction enzymes ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA 36 using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (Table S1) ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were constructed in the pUC19 backbone using NEBuilder Hi-Fi DNA Assembly Mastermix (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA (28) using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (sTable 5) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Cell Biology 2022Quote: ... Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B, P6010, NEB) with or without 1 mM CX4549 (S2248 ...
-
bioRxiv - Biophysics 2021Quote: MukF Flag-tagged fragments were expressed from pET 21 plasmids in C3013I cells (NEB).The Flag-tagged MukE and MuF were at the C-terminus ...
-
bioRxiv - Cell Biology 2022Quote: ... FLAG-MBOAT7 was cloned into the lentiviral vector pRH115-mCherry linearized with XbaI (NEB) and BamHI (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... and ligated into pcDNA5/FRT/TO-N-FLAG-BirA* using Quick Ligation Kit (NEB). Top10 competent E ...
-
bioRxiv - Genomics 2021Quote: ... The PCR reaction consisted of 25 µL NEBNext Hi-Fidelity 2x PCR Master Mix (New England Biolabs NEB.M0541S), 7.5 µL H2O ...
-
bioRxiv - Genomics 2021Quote: ... The PCR reaction consisted of 25 µL NEBNext Hi-Fidelity 2x PCR Master Mix (New England Biolabs NEB.M0541S), 7.5 µL H2O ...
-
bioRxiv - Pathology 2020Quote: ... linearized and transcribed in vitro using the Hi-Scribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA). GAPDH IVT-RNA was purified by precipitation with lithium chloride followed by column purification using the RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... His tagged proteins were eluted with lysis buffer containing 400mM imidazole and bound immediately to amylose resin (NEB) for 1hr ...
-
bioRxiv - Biochemistry 2021Quote: ... fully assembled complexes containing His-Rpn12 and MBP-Rpn6 were purified using a HisTrap and amylose resin (NEB), and cleaved with HRV-protease ...
-
bioRxiv - Cell Biology 2020Quote: ... Igκ-LaNtα31-Myc-His was excised from pGEM®-5Zf(+)-LaNtα31 using NdeI and NsiI (New England Biolabs) and inserted into phK14-mCherry ...
-
bioRxiv - Molecular Biology 2021Quote: ... EcoRI sites underlined) and different concentration of recombinant His-SET8 protein (0 to 1.4 μM, New England Biolabs) were incubated for 10 min on ice in 1× GRB binding buffer [20 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2022Quote: ... Tagmented DNA was amplified by PCR using 1x NEBNext Hi-Fidelity PCR Master Mix (New England Biolabs, NEB), using Nextera Index i5 and i7 series PCR primers ...
-
bioRxiv - Microbiology 2022Quote: ... Tagmented DNA was amplified by PCR using 1x NEBNext Hi-Fidelity PCR Master Mix (New England Biolabs, NEB), using Nextera Index i5 and i7 series PCR primers ...
-
bioRxiv - Bioengineering 2023Quote: ... GLuc was inserted into the digested backbone through Gibson Assembly Hi-Fi kit (New England Biolabs, Ipswich, MA). AAV-hSyn-hM3Dq-RAM-d2tTA was constructed as previously described19 ...
-
bioRxiv - Microbiology 2023Quote: ... Purified PCR products were incubated together in a thermocycler with 1X Hi-Fi DNA Assembly master mix (NEB) at 50°C for one hour ...
-
bioRxiv - Cell Biology 2023Quote: ... sequences of all myc-his tagged RBPs were digested using ClaI and PmeI restrictions enzymes (New England Biolabs), blunted using DNA polymerase I large Klenow fragment (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... falciparum and human histones (New England Biolabs) (6µg) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 U RNase Inhibitor Human Placenta (NEB), 50 pmol Oligo d(T)23 (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Human CK2 was obtained from NEB (P6010S). IE2-NTD was phosphorylated in buffer provided by the manufacturer which contains 50mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Biochemistry 2021Quote: Toxins were expressed with (His)6-tags at their C-termini in competent C43 (DE3) Escherichia coli cells (NEB) for HlgA and in BL21 (DE3 ...
-
bioRxiv - Biochemistry 2021Quote: LCB1 was synthesized and cloned into E.coli using a pET expression vector via Hi-Fi DNA assembly (NEB; E2621S) with a gBlock (ITD ...
-
bioRxiv - Immunology 2021Quote: ... Restriction digest of EtMIC3 PCR product was performed using Bam HI and Eco RI restriction enzymes (New England Biolabs) to extract antigen coding sequence for cloning into pYD1 plasmid vector ...
-
bioRxiv - Biophysics 2020Quote: ... The point mutants were subsequently cloned in the pNZopuAHis plasmid (C-terminal 6-HIS-tag) using EcoRV-AlnwnI (NEB) for the substrate-binding domain mutants and βamHI-AlwnI (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Cell Biology 2021Quote: ... Par-3 PDZ1-APM and PDZ1-APMΔPDZ2 were first his-purified (described above) prior to incubation with amylose resin (NEB). Amylose-bound Par-3 was then washed and resuspended in binding buffer as described for GST proteins.