Labshake search
Citations for New England Biolabs :
301 - 322 of 322 citations for Mouse anti Enterovirus 71 VP1 3657 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated through SDS-PAGE and transferred to a PVDF membrane followed by incubation with anti-MBP monoclonal antibody (E8032S, NEB) and M2 Flag antibody (A8592 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7). In brief ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: ... 72 h post infection (hpi) and analysed by western blotting and pan anti-succinyllysine antibody (PTM-419, PTM Biolabs, Hangzhou, China), and non-inoculated cells served as control group ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was synthesized as described (Schäfer et al., 2018) in the presence of anti-reverse cap analog (NEB or Jena Biosciences) and gel-purified ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 30 minutes in PBS containing the primary antibodies: rabbit polyclonal anti-lactyllysine antibody (PTM-1401, PTM Biolabs, Hangzhou, China), mouse monoclonal anti-tubulin β3 (801201 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies were diluted in the same Triton X 100 and BSA solution and suppliers and source were: primary 1:200 anti-CK20 rabbit D9Z1Z (New England Biolabs, Herts, UK), anti-CD31 mouse JC70/A (Abcam ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were washed with TBS and incubated with a horseradish peroxidase (HRP)-conjugated anti-MBP monoclonal antibody (New England Biolabs; 1:5000).
-
bioRxiv - Cell Biology 2022Quote: ... SNAP-GLP-1R and SNAP-GIPR were detected with an anti-SNAP-tag rabbit polyclonal antibody (P9310S, New England Biolabs, 1/1,000) followed by goat anti-rabbit HRP secondary (ab6271 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Membranes were incubated overnight at 4 °C with the appropriate antibody: rabbit monoclonal anti-GSK3β (1:1,000; product # 9315, Cell Signalling Technology, New England BioLabs, Whitby, Ontario, Canada), rabbit polyclonal anti-p[Ser9]GSK3β (1:500 ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoprecipitation experiments were performed with 15 μL of Pan anti-glycine lysine antibody conjugated to agarose beads (PTM Biolabs, Chicago, IL, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% Tween) with 3% BSA and then incubating the strips in 1:2000 dilution of monoclonal anti-MPB-HRP antibody (NEB, Inc, USA) in a blocking buffer for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were resolved on an 12% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membrane for detection with the following antibodies: anti-Glucocorticoid Receptor D6H2L (1:1000 dilution, Cell Signaling, New England BioLabs #12041), anti-PAX7c (1:500 dilution ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The expression of each engineered component was validated pre- and post-sort by staining Jurkat cells with an anti-Myc antibody (#2233S, NEB, MA, USA), followed by performing flow cytometry on a FACSCanto (BD Biosciences) ...
-
bioRxiv - Microbiology 2021Quote: ... The RNAs were co-transcriptionally capped with m7G anti-reverse cap analog or ApppG Cap Analog (New England Biolabs, 1411 and Cat#1406). The RNAs were purified using a Purelink RNA Mini Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Histone extracts were then resolved on a 15% polyacrylamide gel and Kac levels were determined with Western blot using anti-acetyllysine antibody (PTM Biolabs, Cat# PTM-101), with anti-Knbu/Kibu as the positive control using anti-butyryllysine antibody (PTM Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: ... The precipitates and one-fifth of the supernatant were boiled in SDS loading buffer and subjected to western blot analysis using an anti-MBP monoclonal antibody (New England Biolabs, E8032S, 1:200 dilution), followed by anti-mouse IgG-HRP (Sigma ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...