Labshake search
Citations for New England Biolabs :
451 - 500 of 10000+ citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 1 WFIKKN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... The PCR amplification was performed with 10 µl of the reverse transcriptase product in a 50 µl PCR mix containing 1 unit of Phusion High-Fidelity DNA polymerase (New England Biolabs, Évry-Courcouronnes, France), 1X HF Phusion buffer ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... In vitro RNA methylation experiments were performed for 2 h at 37 °C in 20 μL reaction mixtures containing 1× CutSmart buffer (New England Biolabs Inc., Massachusetts, USA) with 1 μg RNA and 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: ... we dispensed 5 μL of a sense oligo and then added 40 μL of phosphorylation reaction mix containing 1 μL of T4 Polynucleotide Kinase (PNK; NEB, cat. no. M0201S), 5 μL of T4 PNK buffer (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Immunology 2023Quote: All PD-1 mutants were generated using Q5 site-directed mutagenesis kit (NEB) following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was first circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 20 U/μL Exonuclease I (NEB, Cat #M0293), 20 U/μL HinfI enzyme (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 20 μL reaction containing 1X VCE buffer (NEB), 10 μL of the eluted RNA ...
-
bioRxiv - Bioengineering 2020Quote: ... containing 12.4 U/uL RNase If (New England Biolabs) and 0.025 U/uL DNase I (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Effective sgRNA containing constructs were selected by T7E1 (NEB) cleavage assay following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1.5 μl of NEBuffer r2.1 (New England Biolabs). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 0.4 U/ml RNAse inhibitor (New England Biolabs) and were immediately transported to the sequencing facility on ice for further processing.
-
bioRxiv - Biochemistry 2023Quote: ... in 15μl reaction volumes containing the Cutsmart buffer (NEB) or a reconstituted equivalent (50mM Potassium acetate ...
-
bioRxiv - Genomics 2023Quote: ... containing 9U of T4 DNA polymerase (NEB, Cat#M0203S) and 40μM dATG/dGTP and incubated at 20℃ for 4 hours to remove unligated fragments ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 6,25µl of LongAmp Taq 2✕ Master Mix (NEB), 4,25µl of milliQ water ...
-
bioRxiv - Biochemistry 2021Quote: ... and one plasmid was randomly selected from those plasmids and used for expression with a PURE system (PURExpress In Vitro Protein Synthesis Kit, New England BioLabs, Ipswich, MA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted to 1.0 mg/mL protein using homogenization buffer and incubated with 20 U/μL lambda phosphatase in MnCl2 and enzyme buffer as supplied with the lambda protein phosphatase kit (New England Biolabs, Evry-Courcouronnes, France) for 3 h at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Dephosphorylated RNA-protein complexes were then rinsed once with NT2 buffer and 3’-end ligated with T4 RNA Ligase 1 (NEB) overnight in an Eppendorf Thermomixer at 16°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added 150 – 1000 ng of DNA to 1 μl of prepared MBD2-Fc/protein A beads (New England Biolabs), then washed and eluted the DNA as described by Chiou and Bergey (2018) ...
-
bioRxiv - Genomics 2021Quote: ... equal amount of naked DNA and DNA bound by Reb1 protein (~ 5pmol) were incubated with AAG (10 units) and APE1 (1 unit) (New England Biolabs) in a 20 μL reaction containing 1X Thermopol buffer (20mM Tris HCl pH 8.8 ...
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Molecular Biology 2023Quote: ... TIS11B protein-RNA complexes were immunoprecipitated from 1 ml of crosslinked lysate and washed with high salt and PNK buffer (NEB). RNA was repaired by 3′ dephosphorylation and ligated to L3-IR adaptor on beads ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... the reaction was stopped with a final concentration of 50 mM EDTA and the proteins were removed by treatment with proteinase K (1/100 of the volume – NEB) and SDS (0.1% ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using phenol-chloroform and subjected to ribosomal RNA removal using a NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB, Ipswich, MA). A RNAseq library was prepared by using a NEBNext® Ultra directional RNA library prep kit (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 1200 units λ-protein phosphatase (NEB) were diluted into phosphatase assay buffer without cell lysate ...
-
bioRxiv - Microbiology 2021Quote: ... Stained and unstained protein ladders (NEB; #P7719S and #P7717S ...
-
bioRxiv - Molecular Biology 2019Quote: ... 200 units λ protein phosphatase (NEB) was added to 10 μL of the suspension ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1uL of lambda protein phosphatase (NEB) was added to samples ...
-
bioRxiv - Bioengineering 2021Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... and Cas9 protein (NEB - 0.3 μM). This was incubated at 37°C for 10 minutes before microinjection ...
-
bioRxiv - Genetics 2022Quote: ... and Cas9 protein (NEB - 0.3 μM). This was incubated at 37°C for 10 minutes before microinjection ...
-
bioRxiv - Microbiology 2022Quote: ... Color Prestained Protein Standard (NEB, P7719) or Precision Plus Protein All Blue Prestained Protein Standards (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were deglycosylated by PNGaseF (NEB) prior to gel electrophoresis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Cas9 protein was purchased from NEB EnGen Cas9 NLS ...
-
bioRxiv - Microbiology 2023Quote: Protein expression vector pMAL-c5Xa (NEB) was used as the backbone for constructing the mCherry reporter ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein markers (New England Biolabs, #P7719S) were used for molecular mass determination.
-
bioRxiv - Microbiology 2023Quote: ... proteins were deglycosylated by PNGaseF (NEB) prior to gel electrophoresis to facilitate analysis.
-
bioRxiv - Cell Biology 2023Quote: ... and Protein Kinase A (NEB, P6000S) were purchased from New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... including protein disulfide bond enhancer (NEB) and GamS (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... original numbering with signal sequence = 20–559) were subcloned into the manufacturer-supplied plasmid from the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs, Ipswich, MA, USA) using the Gibson assembly method with synthetic E ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.