Labshake search
Citations for New England Biolabs :
401 - 450 of 10000+ citations for Mouse Serine threonine protein kinase PINK1 mitochondrial PINK1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 5’-end radiolabeled DNA was generated with T4 polynucleotide kinase (M0201L, NEB) and [γ-32P]ATP (NEG035C005MC ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated at 5’-termini by T4 Polynucleotide Kinase (M0201, New England Biolabs) and ligated using T4 DNA Ligase (M0202 ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA substrates were 5’ terminally labelled with T4 Polynucleotide Kinase (NEB, M0201S) and ATP-γ-32P (PerkinElmer ...
-
Ribosomal quality control factors inhibit repeat-associated non-AUG translation from GC-rich repeatsbioRxiv - Molecular Biology 2023Quote: ... WT hNEMF was generated by mutating the serine at site 86 to an arginine using Q5 site-directed mutagenesis (NEB, E0554S). pBI-dsRED empty vector was cloned using annealing primers flanked by NheI and EcoRV ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was phosphorylated for 1 h at 37oC with T4 Polynucleotide kinase (NEB or made in-house by the Molecular Biology Service ...
-
bioRxiv - Molecular Biology 2020Quote: Yeast total RNA was first treated with T4 Polynucleotide Kinase (PNK) (NEB M0201S) in order to remove possible phosphorylated 3’ends before polyA tailing ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unprobed and probed RNAs were treated with T4 Polynucleotide Kinase (PNK) (NEB, M0201S) as described above before proceeding with ONT Direct cDNA sequencing.
-
bioRxiv - Genomics 2019Quote: ... the RNA was gel extracted and was dephosphorylated using polynucleotide kinase (NEB #M0201S). A Universal miRNA cloning linker (NEB # S1315S ...
-
bioRxiv - Microbiology 2019Quote: ... RNA fragments were dephosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA), precipitated ...
-
bioRxiv - Genomics 2021Quote: ... 1 µL of 10 U/µL polynucleotide T4 kinase and PNK buffer (NEB) in 20 µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB, M0201L) then ligated onto a 5’ adapter ...
-
bioRxiv - Cancer Biology 2022Quote: Oligos of the gRNAs were annealed with T4 polynucleotide kinase (New England Biolabs) by PCR ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was removed 3’phosphoryl groups using T4 Polynucleotide Kinase (New England Biolabs) in the buffer (70 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Microbiology 2022Quote: RNAs for direct cDNA sequencing were treated with T4 Polynucleotide Kinase (NEB, M0201) following the manufacturer’s non-radioactive phosphorylation protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... Oligo pairs were annealed and phosphorylated by T4 Polynucleotide kinase enzyme (NEB, M0201S), chloroform extracted ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA primer end-labeling was accomplished using T4 polynucleotide kinase (T4 PNK, NEB) and 25 μCi of ATP ...
-
bioRxiv - Microbiology 2019Quote: ... Extracted crRNAs were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, MA, USA), radiolabeled with γ-[32P]-ATP (PerkinElmer ...
-
bioRxiv - Microbiology 2019Quote: ... An aliquot of the purified amplicons was phosphorylated using T4 Polynucleotide Kinase (NEB) using the manufacturer’s recommended reaction mixture and we extended the incubation ...
-
bioRxiv - Developmental Biology 2019Quote: ... Each oligo pair was annealed using T4 Polynucleotide Kinase (PNK) enzyme (NEB, M0201S) and then cloned into the sgRNA(MS2)_puro backbone (Addgene 73795 ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated with 10 U of phosphatase-free T4 polynucleotide kinase (New England BioLabs) for 30 min at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM EDTA) and phosphorylated using T4 Polynucleotide Kinase (New England BioLabs M0201L) according to manufacturer recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... The purified RNA was dephosphorylated with 1 µL of T4 polynucleotide kinase (NEB) in 1x T4 PNK buffer for 1 h at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... by incubating the DNA with T4 polynucleotide kinase (10 units; New England Biolabs) in the reaction medium provided by the supplier for 30 min at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... After end repair (T4 DNA polymerase, T4 DNA polynucleotide kinase, Klenow (all NEB) in the presence of dNTPs in ligation buffer (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... B and C oligonucleotides were phosphorylated with T4 polynucleotide kinase (NEB, Cat #M0201L) according to the manufacturer recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA 5′ ends were phosphorylated with T4 polynucleotide kinase (New England Biolabs). Adapters were ligated to the 5′ and 3′ ends of the RNA and first-strand cDNA synthesis was performed using M-MLV reverse transcriptase ...
-
bioRxiv - Microbiology 2022Quote: ... Linear products were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, MA, USA) for 1 hr at 37°C and circularized with T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: ... the linear PCR product was phosphorylated using T4 polynucleotide kinase (New England Biolabs) and ligated with T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The annealed oligos were phosphorylated using T4 polynucleotide kinase (PNK, New England Biolabs). The phosphorylated and annealed oligos were then diluted in Tris-EDTA (TE ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 10 units T4 Polynucleotide Kinase (PNK) enzyme (New England Biolabs, cat#M0201S) for 2 hours at 37°C in 1X T4 PNK buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL was used in a 10 µL Kinase/Ligase/DpnI (KLD, NEB) reaction and incubated at room temperature for 10-20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.75 µl 0.1 M DTT and 0.3 U/µl T4 Polynucleotide kinase (NEB), and then incubated at 37°C 30 min ...
-
bioRxiv - Genetics 2023Quote: ... and treated with a mixture of USER enzyme and T4 polynucleotide kinase (NEB). DNA was circularized at a concentration of 5 ng/μL with T4 DNA ligase (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... Oligo 1 and oligo 2 were annealed by T4 polynucleotide kinase (NEB, #M0201S) at 37 ℃ for 30 min and 95 ℃ for 5 min ...
-
bioRxiv - Immunology 2023Quote: ... RNA fragments were then 3lll-dephosphorylated using T4 polynucleotide kinase (New England Biolabs) for 6 hours at 37°C in 2-(N-morpholino)ethanesulfonic acid (MES ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was phosphorylated for 1h at 37°C with T4 Polynucleotide kinase (NEB or made in-house by the Molecular Biology Service ...
-
bioRxiv - Genetics 2023Quote: ... The ICU11_sgRNA1_F/R oligonucleotides were phosphorylated using T4 polynucleotide kinase (New England Biolabs) and hybridized in a thermal cycler (Bio-Rad Laboratories T100) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Hairpin oligonucleotides were phosphorylated by T4 polynucleotide kinase (New England Biolabs, Beverly, MA) followed by annealing at 100°C for 5min and cooling in the heat block for 3h ...
-
bioRxiv - Biochemistry 2022Quote: ... were run and then phosphorylated and re-ligated using T4 polynucleotide kinase (NEB) and T4 ligase (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 U/mL creatine kinase) containing 10 µMnt cssDNA (NEB, PhiX virion DNA) was supplemented with Rad51 (5 µM ...
-
bioRxiv - Microbiology 2023Quote: ... 6 ng of sample was treated with 2 units T4 Polynucleotide Kinase (NEB) and incubated at 37°C for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was phosphorylated at the 5’ end by T4 polynucleotide kinase (NEB) and ligated to the 5’ adapter (Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ ends were hydroxy-repaired by adding T4 polynucleotide kinase reaction mix (NEB) which was incubated for 45 minutes at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Single strand DNA oligonucleotides were ligated using T4 Polynucleuotide Kinase (New England Biolabs) using manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by end repair with T4 Polynucleotide Kinase (T4 PNK; NEB, Cat# M0201) at 37°C for 30 minutes ...
-
bioRxiv - Biochemistry 2024Quote: Ribosome-protected fragments were dephosphorylated using T4 Polynucleotide Kinase (M0201, New England Biolabs). Dephosphorylated RNA was extracted using ROTI Acqua P/C/I for RNA extraction (X985.1 ...
-
bioRxiv - Genomics 2024Quote: ... and treated with a mixture of USER enzyme and T4 polynucleotide kinase (NEB). DNA was circularized at a concentration of 5 ng/µl with T4 DNA ligase (NEB) ...