Labshake search
Citations for New England Biolabs :
401 - 450 of 2293 citations for Mouse NRAP shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse α-MBP (NEB, 1:10000); mouse α-Pol II CTD clone 8WG16 (Abcam ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The linearized plasmid was then circularized using a KLD reaction (NEB) and transformed into competent cells via electroporation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5× Q5 buffer and pUC19 plasmid as template (New England Biolabs) in 50 μl ...
-
bioRxiv - Genetics 2021Quote: ... 20 μg of mpra:Δorf plasmid was linearized with AsiSI (NEB, R0630S) and 1x CutSmart buffer (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... plasmid pIG1783-Smkin3-gfp was used for Q5 mutagenesis (NEB biolabs). With specific primers (Table S3) ...
-
bioRxiv - Biochemistry 2022Quote: ... concentrated plasmid samples were digested by XbaI restriction endonuclease (NEB, Canada). 1 mL in vitro transcription reactions were performed using laboratory purified in-house T7 RNA polymerase and commercial RiboLock RNase inhibitor (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The methylated parent plasmid was degraded with DpnI (New England Biolabs), and newly generated plasmid was transformed into OmniMAX chemically competent E ...
-
bioRxiv - Molecular Biology 2021Quote: ... RV-A16 and RV-B14 plasmids were linearized by SacI (NEB) digestion and then in vitro transcribed using HiScribe T7 Transcription Kit (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pMQ30MRR1-L1191H+Q1197* was digested with AscI (New England BioLabs) and AgeI-HF (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... 59.) using BbsI plasmid digest and Gibson Assembly (New England Biolabs). Spacer sequences were as follows:
-
bioRxiv - Immunology 2021Quote: ... Plasmids were transformed in E.coli DH5α competent cells (NEB; Cat,# C2987I). All site-directed changes were confirmed by sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: The reporter plasmid was linearized by digesting it with PmeI (NEB) and BstXI (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... Mutated plasmids were transformed into T7 Express cells (New England BioLabs), plated on LB+100 µg/mL ampicillin agar plates and grown overnight at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting plasmid was then digested with KpnI and NcoI (NEB) for 1 hr at 37°C and ligated with hybridized primers NcoI-KpnI-link-F and NcoI-KpnI-link-R that were similarly digested ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pFETCH mutant and wildtype plasmids were SalI (New England BioLabs) digested prior to transfection to linearize the vector.
-
bioRxiv - Molecular Biology 2019Quote: ... pGP was modified from a commercially available plasmid pCMV-Gluc (NEB), in which contains a set of cellular 5’-noncoding sequences (41 nts ...
-
bioRxiv - Microbiology 2019Quote: ... and Monarch® Plasmid miniprep Kit (New England BioLabs, Ipswitch, MA) was used for purification of plasmid for gene expression and construction of deletion mutant ...
-
bioRxiv - Bioengineering 2019Quote: Single stranded plasmid master mix (3x): 3 U/µL Nb.BbvCI (NEB), 36 U/µL Exonuclease III (ExoIII ...
-
bioRxiv - Neuroscience 2019Quote: ... Using a plasmid linearized with SacI (New England Biolabs, Beverly, MA), it was transcribed with T7 polymerase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid was digested with Xba1 and Ecor1 (New England Biolabs). mCherry was amplified with a 20 bp overhang ...
-
bioRxiv - Genetics 2020Quote: ... Plasmid act5c-Cas9 was digested with EcoRI-HF and XhoI (NEB) and the plasmid backbone was gel purified ...
-
bioRxiv - Bioengineering 2021Quote: ... digestion to remove the parental plasmid followed by NEBHiFi assembly (NEB) to assemble and seal the overlapping ends for improved transformation efficiency ...
-
bioRxiv - Neuroscience 2021Quote: ... Both plasmids were digested with SacI and PstI (New England BioLabs) to obtain fragments containing the vector backbone CD68 promoter and the DIO-eGFP insert ...
-
bioRxiv - Cell Biology 2021Quote: ... the listed plasmids were linearized using BsaBI (New England Biolabs, R0537S) and integrated at the endogenous TUB1 locus by homologous recombination.
-
bioRxiv - Biochemistry 2021Quote: This plasmid was created using NEBuilder HiFi DNA assembly protocol (NEB). In short ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were made by Gibson assembly cloning (NEB BioLabs, Ipswich, MA). Synthetic DNA fragments were obtained from IDT (Coralville ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were made by Gibson assembly cloning (NEB BioLabs, Ipswich, MA). Synthetic DNA fragments were obtained from IDT (Coralville ...
-
bioRxiv - Systems Biology 2021Quote: ... coli clones using the Monarch Plasmid Miniprep Kit (New England BioLabs).
-
bioRxiv - Microbiology 2021Quote: ... This plasmid was further modified using Q5 Site Directed Mutagenesis (NEB) to add the custom adaptors ACACTCTTTCCCTACACGACGCTCTTCCGATCT and GATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Genomics 2021Quote: ... and used to assemble plasmid pools with Gibson assembly (NEB, E2611L). Pools were assembled across 16 Gibson assembly reactions (~900 ng backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... The pTRIP-Ef1α plasmid was linearized by digestion with MluI (NEB), blunted ...
-
bioRxiv - Microbiology 2021Quote: ... the CRISPRi plasmid backbone was digested with BsmBI-v2 (NEB #R0739L) and gel purified ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid DNA from single clones of transformed E.coli (New England Biolabs) was analysed for correct orientation of the insert by Sanger sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... followed by ligated to linearized plasmid using T4 DNA ligase (NEB). For site-directed mutagenesis ...
-
bioRxiv - Microbiology 2021Quote: ... and the Monarch plasmid miniprep kit (New England BioLabs, Ipswich, MA) used for plasmid purification ...
-
bioRxiv - Microbiology 2020Quote: ... and Monarch® Plasmid miniprep Kit (New England BioLabs, Ipswitch, MA) was used for purification of plasmid for gene expression and construction of complement mutant ...
-
bioRxiv - Microbiology 2019Quote: ... plasmids containing sgRNAs were co-transfected with NotI (New England Biolabs)-linearized pTKO ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid was linearized by restriction digest with SpeI (NEB, #R0133) for templated in vitro transcription.
-
bioRxiv - Cell Biology 2022Quote: ... This plasmid was constructed by HiFi- mediated in vitro recombination (NEB) of two PCR based fragments generated by amplifying the pN-PITCh-GFP (Addgene plasmid #127888 ...
-
bioRxiv - Synthetic Biology 2022Quote: Plasmids were assembled using Gibson assembly (New England Biolabs, Cat#E2611S) and purified using a Qiagen QIAfilter Midiprep Kit (QIAGEN ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were transformed into either competent NEB 5-alpha F’Iq (NEB) or Epi400 (Lucigen) ...
-
bioRxiv - Microbiology 2022Quote: ... counter-selectable mutagenesis plasmid pIMAY with T4 DNA ligase (NEB M0202)18 ...
-
bioRxiv - Biochemistry 2022Quote: ... The derivative pT7-spacer-gRNA plasmids were digested with HindIII (NEB) to permit run-off transcription near the 3’ end of the SpCas9 gRNA ...
-
bioRxiv - Biochemistry 2022Quote: ... the plasmid coding for segment 10 was linearized with BsaI (NEB), and the plasmids coding for the remaining segments were linearized using BsmBI (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... All these plasmids were produced by Gibson Assembly (New England Biolabs) after amplification by PCR of mGlu5 ...
-
bioRxiv - Developmental Biology 2021Quote: ... These plasmids were then double digested by SalI and NotI (NEB), and the fragment containing CMV promoter and coding sequence were purified and 0.5 nl of a 200ng/μl ...
-
bioRxiv - Microbiology 2020Quote: ... pMQ30MRR1 complementation plasmids was digested with Not1-HF (New England BioLabs) for transformation.
-
bioRxiv - Microbiology 2020Quote: ... MRR1 complementation plasmids were linearized with Not1-HF (New England BioLabs), cleaned up the Zymo DNA Clean & Concentrator kit (Zymo Research ...
-
bioRxiv - Developmental Biology 2022Quote: The pEntr-EMS plasmid was generated from a HiFi reaction (NEB) using the pEntr3c Gateway cloning (Invitrogen ...