Labshake search
Citations for New England Biolabs :
301 - 350 of 9929 citations for Mouse NLR Family CARD Domain Containing 4 NLRC4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5% NP-40) containing 2 μl RNase Inhibitor (M0314, NEB) and 10 μl m6A antibody (ab151230 ...
-
Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosisbioRxiv - Molecular Biology 2022Quote: Twenty microliter reactions containing 10U Exonuclease VIII truncated (NEB, USA) were set up according to the manufacturer’s instructions and incubated at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL containing 0.01 U Bst 2.0 DNA polymerases (NEB), 0.5 U SplintR ligase (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... enzyme) in the reaction buffer containing 1 × Cutsmart buffer (NEB), 2 mM ATP (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... pSNAPf vector containing SNAP-tag was purchased from NEB (N9183S) and optimised to Drosophila codon suing Genewiz (USA ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse α-MBP (NEB, 1:10000); mouse α-Pol II CTD clone 8WG16 (Abcam ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixed RNA was depleted of rRNA using the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) and fragmented using NEBNext® Magnesium RNA Fragmentation Module (NEB, cat. no. E6150S) for 5 min ...
-
bioRxiv - Genomics 2021Quote: ... exonuclease I (Exol) treatment was performed on all samples by adding 4 ul ExoI buffer and 4 ul ExoI (New England Biolabs, M0293L). Samples were incubated at 37 C for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The polyA containing RNA was then fragmented with fragmentation buffer (NEB)and first strand cDNA was synthesized using random hexamers and M-MuLV Reverse Transcriptase (RNase H-) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 nl of a solution containing 10µM EnGen Cas9 NLS (NEB) and 100 ng/µl of gRNAs was injected at the one-cell stage ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37°C and cDNAs were amplified with KAPA HiFi Hotstart Ready Mix (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% SDS) containing 400 μg/mL Proteinase K (New England Biolabs) and incubated at 65 °C for 1 hr with rotation at 300 RPM ...
-
bioRxiv - Cell Biology 2019Quote: ... reaction buffer containing 1 μL (400 units) lambda phosphatase (P0753S, NEB), reaction buffer containing 1 μL lambda phosphatase plus 1×phosphatase inhibitors cocktail (Roche ...
-
bioRxiv - Genetics 2019Quote: ... each containing 25 µl 2x LongAmp Taq Master Mix (M0287, NEB), 3 µl cDNA PRM primer (cPRM ...
-
bioRxiv - Microbiology 2021Quote: ... in 20μL of reaction mixture containing 1x NEB3 buffer (NEB, USA) and 1u/μL RNasin RNase Inhibitor (Promega ...
-
bioRxiv - Immunology 2021Quote: ... a mix containing 2 μl of RNAse H (NEB, Cat. #M0297S), 1 μl of E ...
-
bioRxiv - Biochemistry 2021Quote: A reaction master mix containing 1X T4 DNA Ligase Buffer (NEB) (2.5 μl/sample volume of 10X T4 DNA Ligase Buffer) ...
-
bioRxiv - Neuroscience 2021Quote: ... Digestion solution containing proteinase K (8U/mL, New England BioLabs, P8107S) was applied to gels and allowed to digest for 2-16 hours (see Results ...
-
bioRxiv - Neuroscience 2020Quote: ... and sorted directly into lysis buffer containing RNAse inhibitor (NEB E6420). cDNA libraries were made from RNA using NEB’s Next Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB E6420) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37℃ and were finally washed once with 0.1x SSC buffer.
-
bioRxiv - Plant Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 3 hours at 37 °C and were finally washed once with 0.1x SSC buffer ...
-
bioRxiv - Genetics 2021Quote: ... We injected worms with an injection mix containing Cas9 EnGen (NEB), 4 sgRNAs against mir-1 (AAGAAGTATGTAGAACGGGG ...
-
bioRxiv - Microbiology 2019Quote: ... plasmids containing sgRNAs were co-transfected with NotI (New England Biolabs)-linearized pTKO ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 150ul of 10X NEB T4 DNA ligase buffer (NEB, B0202), 125ul of 10% Triton X-100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Immunology 2020Quote: ... 0.09% Tween-20) containing 0.2 mg/ml protease K (NEB, P8107S) and incubating at 56°C for 1 hour ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20µL of digestion mix containing 125U HinfI (New England BioLabs, #R0155M) and 25U RsaI (New England BioLabs ...
-
bioRxiv - Neuroscience 2021Quote: Samples containing Nluc-GPC4 were treated with Heparinase II (NEB P0735S) and Heparinase III (NEB P0737S ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Cell Biology 2023Quote: ... A mixture containing 600 ng/uL of Cas9 protein (NEB: M0386) and sgRNA complex at a 1:1 ratio was generated with a total volume of 3 uL ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein-containing fractions were pooled and incubated with Chitin Resin (NEB) for 30 min at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5caC and 5fC containing oligonucleotides were synthesized by NEB (Ipswich, MA). dsDNA oligonucleotides were annealed in 10 mM Tris–HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... pH 8.0) containing 8 units mL−1 proteinase K (NEB, P8107S) at 37 °C for 4 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 mM adenosine-5’-triphosphate (ATP) (New England Biolabs); 2 mM each of guanosine-5’-triphosphate (GTP) ...
-
bioRxiv - Genetics 2020Quote: ... and 4 μl of DNA polymerase I Klenow (NEB), and incubating at 37 °C for 1 hour with rotation ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 μL T4 polynucleotide kinase (New England BioLabs) in a 100 μL reaction for 2 hours and purified using P-30 spin columns (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/µl Taq DNA ligase (M0208S, NEB)).
-
bioRxiv - Molecular Biology 2022Quote: ... including 2.5-4 min fragmentation at 94⁰C (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... 4 U/μl T7 RNA polymerase (NEB - pH 7.9) in a total volume of 150 µl ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 μL T4 DNA ligase buffer (New England Biolabs), 1 μL H2O ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Genomics 2022Quote: ... 4 U of T7 DNA polymerase (New England Biolabs) were used to perform second-strand synthesis and DNA was purified using CleanPCR beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... were mixed with 4 uL T4 buffer (NEB B0202S), 4 uL BbsI-HF (NEB R3539L ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of 5x Phusion HF Buffer (NEB #B0518), and 1.6 µL of 2.5 mM dNTPs (NEB #N0447) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of 5x Phusion HF Buffer (NEB #B0518S), and 0.4 µL of 10 mM dNTPs ...