Labshake search
Citations for New England Biolabs :
201 - 250 of 3401 citations for Mouse IgG2b Isotype Control Antibody Biotin A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 6His(TEV)nsp8 and nsp7L8(TEV)6His were expressed under the control of a T5-promoter in pQE30 vectors in Escherichia coli (E. coli) NEB Express C2523 cells (New England Biolabs) carrying the pRARE2LacI (Novagen ...
-
bioRxiv - Genetics 2020Quote: ... PIK3C2B intron 10 fragment was amplified from the control hPSC genomic DNA and NFIA ORF was amplified from the control hNP cDNA using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs). PIK3C2B intron 10 fragment was cloned into NanoLuc luciferase reporter construct (pNL3.2[NlucP/minP] ...
-
bioRxiv - Genomics 2020Quote: ... we prepared libraries of circle-enriched and whole genomic control samples using NEBNext FS DNA Ultra II Library Prep Kit (New England Biolabs) using protocol modifications outlined in (Sproul and Maddison 2017) ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA templates are prepared by inserting protein-coding sequence of gLuc (pCMV-GLuc control vector, New England BioLabs, Ipswich, MA) into pSP73 vectors (Promega ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA corresponding to selected and diversity control samples were PCR amplified with NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs) as described in20 ...
-
bioRxiv - Microbiology 2023Quote: ... On-bead RNase H treatment control was performed for each reaction: washed beads were incubated with 300 µL 1X RNase H Buffer (NEB) plus 30 units of RNase H (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... The MBP-OsTLP protein or the MBP control protein was bound to amylose resin (New England Biolabs, Beverley, MA, USA), and then the LssaCA-His protein was added to the beads ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned under control of the hlh-3 promoter in pSL780 (Bone et al., 2016) with Gibson cloning (New England Biolabs) to generate pSL814 ...
-
bioRxiv - Microbiology 2023Quote: ... The mWasabi sequence under the control of the constitutive Pleft* promoter45 was amplified by PCR using a Q5 high-fidelity DNA polymerase (New England Biolabs). Plasmids were linearized with KpnI-HF (New England Biolabs) ...
-
bioRxiv - Genetics 2023Quote: ... The expression and activity of the single-vector CROPseq plasmid was tested by cloning in a sgRNA targeting the DNMT3B (sgRNA sequence: CAGGATTGGGGGCGAGTCGG) or LacZ control gene (sgRNA sequence: TGCGAATACGCCCACGCGAT) using Gibson Assembly method and transformed into NEBStable bacteria (NEB) as outlined by Datlinger and colleagues19 and tested in HEK293A cells (Life Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: Control and DRP1 gRNA were cloned into a plasmid containing a U6 promoter using BstXI and BlpI restriction enzymes (NEB) (gifted by Dr ...
-
bioRxiv - Microbiology 2023Quote: ... Secreted cypridina Luciferase (cLuc) activity from the internal control plasmid was similarly measured using the cypridina Luciferase kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... And cloned into a expression plasmid under the control of the EF1α using NEB High-Fidelity DNA Assembly 2x Master Mix (New England Biolabs). To generate 3’ and 5’ stop codon reporters ...
-
bioRxiv - Evolutionary Biology 2024Quote: Plasmids carrying the gfp reporter under the control of different versions of hisJ promoter were constructed using the NEBuilder HiFi DNA Assembly (NEB). Primers used to amplify the backbone or the promoter regions from the evolved bacterial lines are reported in the primer list ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 injected embryos and 8 control uninjected siblings were assayed by PCR amplification and T7 endonuclease (New England Biolabs, M0302S) digest for mutation analysis41 ...
-
bioRxiv - Cell Biology 2020Quote: ... nuclei were spun down and resuspended in fill-in mix (biotin-14-dATP [Thermo Fisher Scientific], dCTP, dGTP and dTTP [Thermo Fisher Scientific], Klenow Polymerase [NEB], 1x NEB 2 buffer) for 1.5 h at 37°C with rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... supernatant was discarded and fill-in mix was added (38 μM Biotin-14-dATP [Thermo Fisher Scientific], 38 μM dCTP, dGTP and dCTP [Thermo Fisher Scientific], 50 U Klenow Polymerase [NEB], 1x NEB 2 buffer) and cells incubated for 1 h at 37 °C under rotation ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Library preparation (from precipitated material and input chromatin as control) was performed using NEBNext Ultra II DNA library Prep Kit (New England Biolabs, #E7645S) without size-selection to maintain sample complexity and according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The guide RNA or scrambled control sequences (Supplementary Table S1) were subcloned into the lentiCRISPR v2 using the BsmBI restriction endonuclease (NEB R0580S). Virus was produced through PEI (MilliporeSigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs) using corresponding primers and probe (MS2_F ...
-
bioRxiv - Biochemistry 2021Quote: ... were synthesized in the TCRB/TCRA orientation (Integrated DNA Technologies) and cloned into a lentiviral vector under the control of the pEF1α promoter using Gibson assembly (New England Biolabs Inc). For generation of TCRs ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Cell Biology 2019Quote: ... The decoupling and control construct were assembled via Gibson cloning using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs). The decoupling construct contained the C-terminal end of the nesprin-3 gene (Syne3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... mCherry and control (GAPDH) expression levels were measured separately by qPCR from 4 uL of diluted cDNA using Taq DNA Polymerase (NEB, #M0270L), dsGreen DNA detection dye (Lumiprobe ...
-
bioRxiv - Cancer Biology 2023Quote: ... NGS sequencing libraries were prepared from 1 µg of genomic DNA spiked with known ‘spike-in’ controls by introducing Illumina adaptors and 5-bp-long index sequences using Q5® High-Fidelity 2X Master Mix (NEB). The barcode amplification was verified in parallel polymerase chain reaction (PCR ...
-
bioRxiv - Genomics 2023Quote: ... Included in the gel as controls were an RT reaction conducted in the absence of tRNA and a Small Range RNA Ladder (NEB N0364S). The gel was stained with SYBR gold and visualized using a ChemiDoc imager (BioRad) ...
-
bioRxiv - Genetics 2024Quote: Wild-type minigene plasmids were prepared using target exons and variable flanking intronic sequences of the DMD gene amplified from a control genomic DNA using Q5 High-Fidelity DNA Polymerase (NEB, USA). The primers that were used are described in Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein blots were incubated with primary antibodies overnight at 4°C using the above-mentioned antibodies and the Gaussia Rabbit Polyclonal Antibody (E8023S, New England BioLabs), the Influenza A NS1 Mouse Monoclonal Antibody (sc-130568 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Cell Biology 2022Quote: SDS-PAGE and Western blot analysis were performed as previously described (Alpy et al, 2005) using the following antibodies: rabbit anti-GFP (1:2000; TP401, Torrey Pine Biolabs), rabbit anti-MOSPD2 (1:250 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragmented RNA was mixed with Protein G Magnetic bead prebound monoclonal anti-m6A antibody (1 µL) from the EpiMark N6-Methyladenosine Enrichment Kit (New England Biolabs), resuspended in 300 µl EpiMark IP buffer supplemented with murine RNase inhibitor (New England Biolabs) ...
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Microbiology 2021Quote: ... CRISPR constructs were generated by cloning an ACE2-targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: DNA encoding XFP1-10 protein was transformed and expressed under the control of an arabinose inducible promoter in Escherichia coli strain BL21(DE3) (New England BioLabs, Ipswich, MA). Cells were grown in Luria broth medium to an initial optical density of 0.2 ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA of TET21-N cells (Control and 24 h doxycycline) was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs, Hitchin, UK), from which complementary DNA (cDNA ...
-
bioRxiv - Bioengineering 2024Quote: Linear dsDNA templates were made via PCR amplification was done using the GD2-CAR or no CAR Control plasmid as a template using Q5 Hot Start Polymerase (Cat # M0494S, NEB, Ipswich, MA) in 50 uL reaction volumes ...
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were analyzed by SDS-PAGE and western blotting by using antibodies against MBP (1:1000, New England Biolabs, E8038S) or GST (1:1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Microbiology 2021Quote: ... Firefly luciferase (FLuc) RNA served as the spike in control and was generated using HiScribe T7 Quick RNA Synthesis kit (NEB, Ipswich, MA, USA) using linearized plasmid DNA encoding FLuc gene as template ...
-
bioRxiv - Genomics 2020Quote: ... Long dsRNAs for R1 and R2 of the Dg vATPase A gene and lacZ control gene (120 μg of each dsRNA) were incubated with 0.2 units/μL ShortCut® RNase III (New England BioLabs, Ipswich, MA, USA) for 3 h at 37°C to produce a heterogeneous mix of short (18-25 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... rTg4510 mouse brain sections were incubated in the absence (control) or presence (treated) of 10,000 U/mL λ phosphatase (New England Biolabs, cat. no. P0753) for 24 hours at RT ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti Pan-Keratin (clone C11, NEB, 4545S). Primary antibodies were incubated with sections overnight at 4°C except for anti-CD3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).