Labshake search
Citations for New England Biolabs :
51 - 100 of 3336 citations for Mouse IgG2b Isotype Control Antibody A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Unmethylated control plasmid was produced in dam− bacteria (New England BioLabs #C2925H) and methylation status was confirmed by DpnI and DpnII digestion ...
-
bioRxiv - Developmental Biology 2019Quote: ... and cloned into the control plasmid using restriction enzyme XhoI (NEB, #R146L). pCAGGS-Cre plasmid was generated as described (Kranz et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... A positive control was prepared by substituting casein kinase II(NEB, P6010S) for galectin 3 in the reaction mixture.
-
bioRxiv - Biochemistry 2023Quote: ... of the SARS-CoV-2 Positive Control (N gene) plasmid (NEB N2117). Sanger sequencing confirmed successful mutagenesis ...
-
bioRxiv - Microbiology 2021Quote: ... or murine anti-MBP monoclonal antibody (1:10,000; NEB; catalog# E8032S) in the above LI-COR blocking buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... DHFR control plasmid from PURExpress In Vitro Protein Synthesis Kit (New England Biolabs) was used as backbone for subsequent ligations ...
-
bioRxiv - Cell Biology 2023Quote: ... and pSNAPf-H2B control plasmid (Addgene #101124, New England Biolabs and Ana Egana) using KpnI and NotI ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA (1 µg) extracted from adult mouse testes was treated with alkaline phosphatase (NEB), de-phosphorylated ...
-
bioRxiv - Cancer Biology 2021Quote: ... The membrane was incubated with HRP-conjugated secondary antibodies (1:5000, NEB) for 45 mins at RT ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... the FLuc Control Template from the HiScribe T7 high yield RNA synthesis kit (NEB) was in vitro transcribed and purified as described the linearized pTXB1 vector.
-
bioRxiv - Biochemistry 2021Quote: ... Control samples containing only RNA were treated with RNA 5’ Pyrophosphohydrolase (RppH, NEB, M0356S) to convert 5’-PPP RNA into 5’-P RNA ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Genomics 2020Quote: ... As a control plasmid pCMV6 plasmid (4.6kb) was linearized by digestion with NdeI (NEB, RO111). 180 ng control linearized plasmid DNA and 180 ng of 3C library was treated with either 0.5 Unit exonuclease V (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Library concentration and quality control were determined using NEBNext Library Quant Kit (New England Biolabs) and Agilent High Sensitivity D1000 ScreenTape System (Agilent ...
-
bioRxiv - Biochemistry 2020Quote: ... together with controls were subject to enzymatic digestion by PNGase F (P0708L, New England Biolabs), Endo H (P0702L ...
-
bioRxiv - Cell Biology 2022Quote: ... and either incubated with buffer control or lambda protein phosphatase (λ) (New England Biolabs; P0753) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... A fully methylated control sample (CpG Methylated HeLa Genomic DNA; New England BioLabs, MA, USA) was included in a random position on each plate to facilitate plate tracking ...
-
bioRxiv - Immunology 2020Quote: ... m6A-positive and m6A-negative control oligonucleotides (EpiMark N6-Methyladenosine Enrichment Kit, New England Biolabs) were spiked into total RNA prior to immunoprecipitation ...
-
bioRxiv - Microbiology 2022Quote: ... Open circular plasmid control was obtained by incubation with the Nt.BspQI nickase (New England Biolabs), and linear plasmid by cleavage with BamHI.
-
bioRxiv - Cancer Biology 2023Quote: ... A negative control treated for 4 hours at 37 °C with RNaseH1 (New England Biolabs) was included for each condition ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound protein was detected by western blot using mouse anti-MBP diluted 1:10,000 (New England Biolabs), fluorescent secondary antibodies (Li-Cor Biosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... + 5 % non-fat milk for 1 hour at room temperature before incubating with primary antibody: anti-GFP (1:1000, Biolabs) or anti-actin (1:5000 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: Specific antibodies against Slug (C19G7, Cell Signaling Technology, NEB, Frankfurt, Germany, #9585, 1:400), pan-cytokeratine (polyclonal ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were then incubated for 1 hour with anti-MBP antibody (New England BioLabs) solution diluted in calcium containing blocking buffer ...
-
bioRxiv - Genomics 2019Quote: Genomic control DNAs were digested to nucleosides by treatment with the Nucleoside Digestion Mix (NEB, M0649S) for 1 h at 37 C ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were incubated for 15 min either with PBS (control) or DNase I (10U) (NEB M0303) or RNase A (2mg/mL ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies used were anti-PDGF-Ra (rabbit, New England Biolabs, 1:400 dilution), anti-APC (clone CC1 ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was then probed with the primary anti-MBP antibody (NEB E8032S, 1:10000) diluted in 5% NFDM (overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and RpoD control were assessed using the Luna Universal One-Step qRT-PCR kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used for immunoblots in this study were anti-tau (tau46) (1:5000; NEB 4019S), anti-human tau (tau13 ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... A positive control GTase reaction using 0.5 U / μL of the vaccinia capping enzyme (New England Biolabs #M2080S) in place of the SARS-CoV-2 RdRp was performed under similar conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... Oligos (IDT) were cloned into lentiCRISPR-v1 (controls) or lentiCRISPR-v2 (SLC25A40 and TXNRD2) using T4 ligase (NEB). Ligation products were cloned into Escherichia coli (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Standard curve was prepared using SARS-CoV-2 Positive Control plasmid containing full nucleocapsid protein (N gene) (NEB) and used to quantify copies of N gene in organoid samples ...
-
bioRxiv - Cell Biology 2023Quote: ... For an R-loop negative control the preparation was treated with 5 U RNaseH (M0297S, NEB Japan, Japan) in 1× RNaseH Reaction Buffer (NEB Japan ...
-
bioRxiv - Microbiology 2023Quote: ... Hep3B cells and HBV control HepG2 2.2.15 cells and subjected to PCR amplification using the LongAmp Taq kit (NEB) and HBV primers spanning the CTCF binding motifs (HBV2 forward and Hep23B reverse) ...
-
bioRxiv - Microbiology 2023Quote: ... These constructs were placed under the control of the T7 promoter and inserted into EcoRI (New England Biolabs) and NotI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... the positive control and each viral mutant plasmid was constructed using the Q5 site-directed mutagenesis kit (NEB) according to manufacturer protocol and verified via whole plasmid sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibodies used in this study were rabbit anti-GLuc 1:2,000 (E8023S, New England Biolabs), rabbit anti-epidermal growth factor receptor (EGFR) ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoprecipitation was performed overnight under rotation at 4 using 1/100 T7RNA antibody (Biolabs CB MAB-0296MC) and antiflag (Sigma F1804 and F3165) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...