Labshake search
Citations for New England Biolabs :
51 - 100 of 10000+ citations for Mouse Caprin 1 CAPRIN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Point or deletion mutations were prepared from human or mouse CRT expression clones in pCMV3-C-Myc (SinoBiological) using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s protocol and primers designed using the NEBaseChanger™ web tool ...
-
bioRxiv - Systems Biology 2020Quote: ... rRNA depletion and library preparation for sequencing was completed with the NEBNext protocol (‘Protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared according to the protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA from 1000 ng total extracted RNA was depleted using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat; New England Biolabs Inc.). The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc. ...
-
bioRxiv - Genomics 2023Quote: Mouse tail (1cm) was used to extract the genomic DNA (gDNA) using NEB Monarch® Genomic DNA Purification Kit (NEB T3010L). DNA concentration was measured on Qubit dsDNA BR assay kit (cat ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µg RNA was reverse transcribed using LunaScript RT SuperMix Kit (NEB). qPCR was performed using synthesised cDNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: DNAse-treated RNA with high RIN value was used to deplete ribosomal RNA using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6350) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... sgRNA target site mutation in mouse Thap1 cDNA was generated by Q5 Site-Directed Mutagenesis Kit (NEB, see Table S3 for primers). WT or Thap1-/-Brca1Δ11 MEFs (1 × 106 ...
-
bioRxiv - Microbiology 2021Quote: ... ribosomal RNA depletion was carried on the extracted RNA using Nebnext rRNA depletion kit (Human/mouse/rat) (New England BioLabs. In, USA). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... RNA-seq libraries were prepared from RNA samples (150ng) using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB Cat# E7405) in conjunction with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB Cat# E7765) ...
-
bioRxiv - Biochemistry 2023Quote: ... An mRNA transcript library for Illumina sequencing was created using the NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs, Ipswich, MA). A NextSeq 500 sequencer (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Immunology 2023Quote: All PD-1 mutants were generated using Q5 site-directed mutagenesis kit (NEB) following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was first circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using phenol-chloroform and subjected to ribosomal RNA removal using a NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB, Ipswich, MA). A RNAseq library was prepared by using a NEBNext® Ultra directional RNA library prep kit (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Neuroscience 2021Quote: Libraries were prepared from 1 ug RNA using a library prep kit (NEB #7770), rRNA depletion kit (NEB #E6310) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μg RNA was reverse transcribed to cDNA using LunaScript RT SuperMix Kit (NEB). qPCR was performed in 20 μl reactions containing diluted cDNA ...
-
bioRxiv - Genetics 2024Quote: ... immunoprecipitated RNA and 1% input RNA Monarch RNA Cleanup Kit (New England Biolabs, T2047L) was used according to the manufacturers’ instructions ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixed RNA was depleted of rRNA using the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) and fragmented using NEBNext® Magnesium RNA Fragmentation Module (NEB, cat. no. E6150S) for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... the purified cDNA was PCR amplified and barcoded using ONT’s PCR Barcoding Expansion 1-12 (EXP-PBC001) or PCR Barcoding Expansion 1-96 (EXP-PBC096) kits with LongAmp Taq 2x Mastermix (NEB, Ipswich, MA).
-
bioRxiv - Genomics 2019Quote: ... expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1) expressing ATG7 isoform 1 was derived from pCMV-myc-Atg7(2) using the Q5 site-directed mutagenesis kit (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Developmental Biology 2022Quote: ... (2019): 1) the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760) was used for library preparation ...
-
bioRxiv - Genomics 2019Quote: ... mRNAs were isolated from 1 μg of total RNA using a PolyA selection kit (NEB) and sequencing libraries were prepared using the NEBnext Ultra RNA library prep kit for Illumina (NEB) ...
-
bioRxiv - Genetics 2019Quote: ... mRNAs were isolated from 1 μg of total RNA using a PolyA selection kit (NEB) and sequencing libraries were prepared following instructions from NEBs Ultra Library Preparation Kit for Illumina ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μg total RNA was depleted of rRNA using the NEBNext rRNA Depletion kit (NEB). To capture nascent RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and the amplicons were extracted from a 1% agarose gel (Monarch Gel Extraction Kit, NEB). Inserts were then cloned into a pCDH1 lentiviral vector ...
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Immunology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). The Hifi assembly products were Ampure bead purified and eluted into 20 µL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour HiFi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). HiFi assembly products were Ampure bead purified and eluted into 20uL of H2O for higher electroporation efficiency.
-
bioRxiv - Cell Biology 2020Quote: The PAQR-2p∷PAQR-1∷GFP construct was generated with a Gibson assembly cloning kit (NEB) with the following three fragments ...
-
bioRxiv - Molecular Biology 2019Quote: ... The Cap 1 25mer RNA was purified using Monarch RNA Cleanup kit (50 μg capacity, NEB). Complete methylation was verified by digestion of RNA with the Nucleoside Digestion Mix (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μg of linearised DNA was then used in a HiScribe T7 synthesis kit (NEB), before DNase treatment and purification using a PureLink RNA mini kit (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... 1 µg of RNA was used for cDNA synthesis using the LunaScript RT SuperMix Kit (NEB) with and without reverse transcriptase (RT) ...
-
bioRxiv - Cell Biology 2020Quote: ... gel purified and ligated with pENTR (w158-1)-backbone by Quick Ligation kit (New England Biolabs) to create pENTR-GRET ...
-
bioRxiv - Cell Biology 2020Quote: β1-tubulin wild type construct was generated by the gibson assembly (HiFi Kit, New England Biolabs) of a TubB1 sequence fragment synthesised as a gBlock by Integrated DNA Technologies (IDT ...
-
bioRxiv - Genomics 2021Quote: ... ribosomal RNA depletion was performed using 1 μg RNA using NEBNext rRNA Depletion kit (NEB#6310). Concentration of final libraries was measured using Qubit 2.0 Fluorometer in combination with Qubit dsDNA HS Assay Kit (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg was used to generate dsRNA using a HiScribe T7 RNA synthesis kit (NEB). Reaction products were purified with the GeneJET RNA Purification Kit (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl 10 pM/μl and previously adenylated using the 5′ DNA adenylation kit (NEB, E2610S), and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L) ...
-
bioRxiv - Cell Biology 2023Quote: ... Two micrograms of total RNA was circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:100 and used for the ligation using the Quick Ligation Kit (New England Biolabs). Specific base pair substitutions were introduced with site directed mutagenesis by polymerase chain reaction (PCR) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of total RNA was reverse transcribed using LunaScript RT SuperMix Kit (New England Biolabs) according to the manufacturer’s instructions and 1 µl cDNA was used as a template for a 10 µl qPCR reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg of RNA was used for cDNA synthesis using the LunaScript RT SuperMix Kit (NEB) with and without reverse-transcriptase ...