Labshake search
Citations for New England Biolabs :
101 - 150 of 10000+ citations for Mouse Butyrophilin Like Protein 2 BTNL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 1.4 μM of each purified mRNA was used in PURExpress in vitro Protein Synthesis Kit (NEB#E6800) in 10 μl reaction in 384 well Small Volume black plate (Grenier 788 096) ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment(anti-sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Microbiology 2022Quote: ... a sequencing library was constructed with the NEBNext ARTIC SARS-CoV-2 FS kit (NEB E7658S). For each viral variant ...
-
bioRxiv - Cancer Biology 2023Quote: ... TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Molecular Biology 2023Quote: crRNA (Supplementary Table 2) was synthesized using a HiScribe T7 High Yield RNA Synthesis Kit (NEB). The DNA sequences includes the T7 promoter at the 5’ end and the sequence from crRNA with the target sequence at the 3’ end ...
-
bioRxiv - Molecular Biology 2022Quote: ... We then carried out rRNA depletion with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat NEB # E6310S) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and libraries were prepared using the NEBNext rRNA Depletion Kit for Human/Mouse/Rat (NEB Cat#E6310). Adapter-ligated cDNA was amplified with 11 cycles of PCR to generate libraries ∼300 bp in length ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... Selected candidates were expressed in vitro using the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: N-terminal GST-fusion TF DBD proteins were expressed using the PURExpress in vitro transcription/translation kit (NEB) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: Cell-free transcription and translation reactions were carried out using PURExpress® In Vitro Protein Synthesis Kit (NEB) following the manufactureŕs protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2020Quote: cDNA was synthesized from 2 μg RNA using the ProtoScript II First Strand cDNA Synthesis Kit (NEB) per manufacture’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA from 2 biological replicates was purified with Monarch PCR & DNA Cleanup Kit (Cat. no. T1030, NEB). Library preparation ...
-
bioRxiv - Genetics 2020Quote: ... corresponding to the point mutation in the SARS-CoV-2 genome (Q5 Site-directed mutagenesis kit, NEB). Site directed mutagenesis primers (Table S1 ...
-
bioRxiv - Cancer Biology 2021Quote: Libraries were prepared using the NEBNext Ultra 2 DNA Library Preparation Kit (New England Biolabs, MA, USA) with AMPure® XP Beads (Beckman Coulter ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB) with the CDC-derived primers for N1 and N2 gene targets and the reaction was performed using the QuantStudio™ 5 System (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... 2 μg of total RNA was converted into cDNA with LunaScript RT SuperMix kit (New England Biolabs). The cDNAs were used as templates for real-time PCR and ran on StepOnePlus real-time PCR system (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was isolated from ∼2×106 cells using the Monarch DNA purification Kit (New England Biolabs). For genotyping ...
-
bioRxiv - Biochemistry 2022Quote: ... protein was treated overnight with Lambda Protein Phosphatase (NEB #P0753S) at 4 °C.
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Neuroscience 2021Quote: ... Cas9 protein (NEB) was mixed with all six sgRNAs and injected into embryos at the 1-cell stage ...
-
bioRxiv - Plant Biology 2024Quote: ... SpCas9 protein (NEB), 1 x cut smart buffer (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1600 v/10 ms /3 pulses for 200,000 cells in Buffer R (Neon Transfection kit) premixed with 50 pmol Cas9 protein (CAT#M0646T, New England Biolabs), 50 pmol single guide RNA (sgRNA ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant C-terminally FLAG-Tagged TEX264 was produced by PURExpress in vitro protein synthesis kit (E6800; New England Biolabs). Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B ...
-
bioRxiv - Physiology 2021Quote: ... The biotinylated peptides were placed on streptavidin-coated plates and three rounds of solid-phase panning were conducted using 109 random 12-mer peptides fused to a minor coat protein of M13 (pIII) following the manufacture’s protocol (Ph.D-12 Phage Display Peptide Library Kit, NEB, E8110S). Sequenced data were subsequently analyzed as follows ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... see Supplementary Data 6) and cloned into pDHFR vector provided in the PURExpress In Vitro Protein Synthesis Kit (NEB). The translation into liposomes was done as described previously95 and the output was analyzed by Blue Native PAGE using 2% digitonin and NativePAGE Novex 4-16% Bis-Tris Protein Gel (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... 20 ng of each integrase amplicon was used per reaction using PURExpress® In Vitro Protein Synthesis Kit (NEB) in a total volume of 9 µl ...
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were then mixed with Blue Protein Loading Dye (NEB) boiled for 10 minutes and separated on 10% SDS-PAGE gel for 50 minutes at 140 V ...
-
bioRxiv - Plant Biology 2021Quote: ... and extracted nuclear proteins were treated with lambda protein phosphatase (NEB) according to the manufacturer’s instruction.
-
bioRxiv - Genomics 2020Quote: ... Endogenous proteins were captured onto protein G-magnetic beads (NEB; #S1430S), washed extensively in IP buffer and used for POT1wtand POT1V29L source ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...