Labshake search
Citations for New England Biolabs :
151 - 200 of 361 citations for Mouse Anti Tick borne Encephalitis Virus NS1 M836 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Anti-butyryllysine antibody (PTM BioLabs, PTM#301) at 1:2000 dilution was incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Systems Biology 2022Quote: ... anti-SNAP (1:1000, rabbit, NEB, P9310S); anti-MRPS18B ...
-
bioRxiv - Genetics 2020Quote: ... anti-MYC-tag (Cell Signaling Technology/NEB) at 1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... pan anti-glutarylysine (PTM-1151, PTM Biolabs) and pan anti-acetyllysine (PTM-105 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Immunology 2022Quote: ... anti-Histone H3 (4499, New England Biolabs) and anti-mouse IgG-HRP (Santa Cruz Biotechnology) ...
-
bioRxiv - Immunology 2022Quote: ... anti-α-tubulin (2144, New England Biolabs), anti-Histone H3 (4499 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and rabbit anti-NANOG (New England Biolabs). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-H3K9la (PTM BIOLABS, PTM1419RM, 1:1000), anti-H3K14la (PTM BIOLABS ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-H3K14la (PTM BIOLABS, PTM1414, 1:1000), anti-H3K18la (PTM BIOLABS ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-H3K18la (PTM BIOLABS, PTM1406, 1:1000), and anti-H4K12la (PTM BIOLABS ...
-
bioRxiv - Biochemistry 2023Quote: ... and Anti-MBP (NEB E8032S, 1:10000). Secondary antibodies include IRDye 680RD goat anti-rabbit (LI-COR 926-68071 ...
-
bioRxiv - Genetics 2023Quote: ... and anti-rabbit HRP conjugated (NEB #7074) and anti-mouse HRP conjugated (Cell Signaling Technologies #7076 ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... CREB (CCDS15005.1) and CRTC1 (CCDS40372.1) were amplified from mouse brain cDNA library by primers contain AgeI-HF (R3552L, NEB) and BamHI-HF (R3136L ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... mCapH2 (Gene ID: 52683) genes were PCR amplified from human and mouse genomic DNA with Q5 polymerase (NEB). The lengths of homology arms are featured in electronic supplementary material Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Neuroscience 2024Quote: Mouse Hapln1 (NM_013500) was cloned into the pAAV vector by PCR with the following primers and ligase (NEB) or In-Fusion cloning (Takara) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatants were immunoprecipitated overnight with 40 µL of precoated anti-IgG magnetic beads (goat anti-rabbit IgG magnetic beads, NEB) previously incubated with the antibody of interest for 4 h at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... or anti-H3K9bhb (PTM Biolabs cat # PTM-1250) diluted 1:2,000 in blocking solution ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SNAP-tag (P9310, New England BioLabs), rabbit anti-beta-tubulin (NB600-936 ...
-
bioRxiv - Cell Biology 2020Quote: ... Pan anti-trimethyllysine (rabbit, PTM Biolabs, PTM-601), SETD2 (rabbit ...
-
bioRxiv - Cell Biology 2019Quote: ... or rabbit anti-GAPDH (2118S NEB, 1:5000) primary antibody with horseradish peroxidase-conjugated anti-mouse or anti-rabbit (Dianova 1:10,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-insulin was from Sigma (I-2018) and anti-SNAP from NEB (P9310S). The coverslips were mounted on glass slides with VectaShield Antifade Mounting Medium and fixed with nail polish ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-Gaussia luciferase (E8023, New England Biolabs) at a 1:2,000 dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-malonyl-lysine (PTM Biolabs, Cat. #PTM-901), anti-succinyl-lysine (PTM Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... and pan anti-acetyllysine (PTM-105, PTM Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... anti-glutaryl-lysine (PTM Biolabs, Cat. #PTM-1151), anti-ACC (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-succinyl-lysine (PTM Biolabs, Cat. # PTM-401), anti-glutaryl-lysine (PTM Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-H4K12la (PTM BIOLABS, 1:1000, PTM1411RM). The next day ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-succinyllysine (PTM Biolabs, PTM-401, 1:1000), anti-MYC (and anti-SUCLG2 (Bethyl Laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit, NEB). Detailed sub-cloning information is available upon request.
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... and murine lung slices were incubated overnight with primary antibodies in 0.1% BSA as follows: anti-CDH1 (clone EP700Y, Biozol, 1:250) or anti-CDH1-Alexa-488 (clone 24E10, New England Biolabs, 1:50), anti-Twist1 (clone Twist2C1a ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated with mouse anti-CaMKIIα (6G9) (1:1000, Pierce Biotechnology, Catalog #MA1-048) and rabbit anti-Gaussia luciferase (1:1000, New England BioLabs, Catalog #E8023S) overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...