Labshake search
Citations for New England Biolabs :
501 - 518 of 518 citations for Mouse Anti Staphylococcus Aureus Enterotoxin G Antibody SEG 59 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL phosphorylation mix (1µL 100mM sense oligo, 1µL 100mM anti-sense oligo, 0.5µL 25mM ATP (BioLabs #P0756S), 1µL 10X PNK T4 Buffer (BioLabs #B0201S) ...
-
bioRxiv - Plant Biology 2022Quote: ... and the ubiquitinated ERECTA_CD were detected by IB analysis with anti-MBP (E8032, 1:10,000, New England Biolabs) as primary antibody ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein amounts of OP18 and beta-actin were quantified using a primary stathmin polyclonal antibody (1:1000; Cell Signaling Technology, NEB GmbH, Frankfurt/Main, Germany) and a polyclonal beta-actin antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment (sense/anti-sense) Pceh-23_L::acy-2 fragment(sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2019Quote: ... the purified C-I30-Flag protein (30µl beads) was digested on beads (Anti-FLAG M2 affinity gel) with final 5U Enterokinase (cat#: P8070S, NEB) in the 1x EK reaction buffer (20 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... the purified C-I30-Flag protein (30µl beads) was digested on beads (Anti-FLAG M2 affinity gel) with final 10U CIP Phosphatase (cat#: M0290S, NEB) in the 1x CIP buffer (50 mM Potassium Acetate ...
-
bioRxiv - Developmental Biology 2021Quote: ... Positive clones were digested with the appropriate enzyme to linearize the plasmid and anti-sense ribonucleoprobe synthesis was carried out using Sp6 or T7 RNA polymerase (New England Biolabs)+DIG labeled UTP (Roche) ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA used in this study was capped with either m7G (Anti-Reverse Cap Analog [ARCA], S1411L) or ApppG cap analog (S1406S, New England Biolabs).
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Biochemistry 2023Quote: ... Bleo-treated WT-PNKP-FLAG and K226R-PNKP-FLAG cells using 10 μg of custom-made rabbit polyclonal anti-AcK226 Abs (Ez Biolabs). All other subsequent steps and buffers used for IP were the same as described earlier (17,18) ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was synthesized as described (Schäfer et al., 2018) in the presence of anti-reverse cap analog (NEB or Jena Biosciences) and gel-purified ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies were diluted in the same Triton X 100 and BSA solution and suppliers and source were: primary 1:200 anti-CK20 rabbit D9Z1Z (New England Biolabs, Herts, UK), anti-CD31 mouse JC70/A (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... The RNAs were co-transcriptionally capped with m7G anti-reverse cap analog or ApppG Cap Analog (New England Biolabs, 1411 and Cat#1406). The RNAs were purified using a Purelink RNA Mini Kit (Thermo Fisher Scientific ...