Labshake search
Citations for New England Biolabs :
351 - 400 of 522 citations for Mouse Anti Nipah Virus Glycoprotein G IG10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit, NEB). Detailed sub-cloning information is available upon request.
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... and murine lung slices were incubated overnight with primary antibodies in 0.1% BSA as follows: anti-CDH1 (clone EP700Y, Biozol, 1:250) or anti-CDH1-Alexa-488 (clone 24E10, New England Biolabs, 1:50), anti-Twist1 (clone Twist2C1a ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated with mouse anti-CaMKIIα (6G9) (1:1000, Pierce Biotechnology, Catalog #MA1-048) and rabbit anti-Gaussia luciferase (1:1000, New England BioLabs, Catalog #E8023S) overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Microbiology 2024Quote: ... AnTat1.1 sequence was obtained from AnTat1.1 specific cDNA from mouse infection D6 cloned into a pMiniT vector with the PCR Cloning Kit (NEB, E1202S). VSG-228 was partially amplified from VSG PCR (see below ...
-
bioRxiv - Cell Biology 2020Quote: ... and anti-Kcr (Catalog No. PTM-501, PTM Biolabs).
-
bioRxiv - Microbiology 2019Quote: ... and detected using anti-MBP antibodies (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal anti-SNAP-tag (New England BioLabs, P9310S), mouse monoclonal anti-HSP90 (BD Transduction Laboratories ...
-
bioRxiv - Developmental Biology 2019Quote: ... incubated overnight with anti-SNAP antibody (NEB, Ipswich, MA), washed and probed with goat-anti-rabbit horseradish peroxidase secondary antibody (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected using the anti-MBP-HRP antibody (NEB). The bound protein (~42kDa ...
-
bioRxiv - Microbiology 2022Quote: ... anti-Tubulin (1:2500 dilution, PTM Biolabs, PTM-1011), and anti-ubiquitination (1:2500 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... and anti-MBP (E8032, 1:10,000, New England Biolabs) antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: Anti-M13-pIII monoclonal antibody (E8033S, New England Biolabs), sheep anti-mouse IgG (H/L):HRP (AAC10P ...
-
bioRxiv - Plant Biology 2023Quote: ... after which an anti-p42/p44-erk antibody (NEB) was employed to detect the activated MAPKs on western blots.
-
bioRxiv - Cell Biology 2023Quote: ... anti-SNAP-tag antibody (New England Biolabs, Ref. P9310S), anti-clathrin heavy chain antibody (BD Bioscience ...
-
bioRxiv - Microbiology 2024Quote: ... and detected using anti-MBP antibodies (New England Biolabs). As a negative control ...
-
bioRxiv - Developmental Biology 2024Quote: ... or anti-MBP (New England Biolabs E8032, 1:5,000), goat anti-mouse IRDye 800 (Li-Cor Biosciences 926-32210 ...
-
bioRxiv - Immunology 2021Quote: Point or deletion mutations were prepared from human or mouse CRT expression clones in pCMV3-C-Myc (SinoBiological) using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s protocol and primers designed using the NEBaseChanger™ web tool ...
-
bioRxiv - Systems Biology 2020Quote: ... rRNA depletion and library preparation for sequencing was completed with the NEBNext protocol (‘Protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Neuroscience 2021Quote: The moPrP-eGFP_39/40 fusion construct carrying eGFP within the flexible N-terminal tail between aa 39 and 40 of mouse PrP was created using NEB® Golden Gate Assembly (New England Biolabs). In brief ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2022Quote: ... DNA fragments ranging from 3 kb to 5 kb with 40-100 bp terminal homologies were amplified from mouse BAC RP23-51O13 with Q5 polymerase (NEB, M0491L). Approximately equal amount (100 ng ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared according to the protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA from 1000 ng total extracted RNA was depleted using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat; New England Biolabs Inc.). The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc. ...
-
bioRxiv - Genomics 2023Quote: Mouse tail (1cm) was used to extract the genomic DNA (gDNA) using NEB Monarch® Genomic DNA Purification Kit (NEB T3010L). DNA concentration was measured on Qubit dsDNA BR assay kit (cat ...
-
bioRxiv - Plant Biology 2020Quote: ... pan-anti-Khib (PTM Biolabs, China, Catalog No. PTM-801), and pan-anti-acetyllysine (pan-anti-Kac ...
-
bioRxiv - Physiology 2022Quote: ... anti-MBP (1:10,000, catalog no. E8032S, New England Biolabs); anti-CCNA2 (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-GFP (1:1000; TP401, Torrey Pine Biolabs, RRID:AB_10013661), mouse anti-GFP (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 50 μL anti-MBP (New England Biolabs) at 3 ug/mL in Tris Buffered Saline (TBS ...
-
bioRxiv - Microbiology 2021Quote: ... or 5 µl anti-H3K18cr antibody (PTM-517, PTM Biolabs) together with protein A agarose (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 7.4) and probed with anti-succinyl lysine (PTM Biolabs), then probed with secondary antibody in milk in Tris-buffered saline ...