Labshake search
Citations for New England Biolabs :
451 - 500 of 503 citations for Mouse Anti MERS Coronavirus Spike S1 Antibody 3871 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Anti-sense probe templates were either linearized with Sac2 (New England BioLabs #R0157S) and synthesized with SP6 RNA polymerase (Promega #P108G ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Bioengineering 2024Quote: Full length heavy and light chains for each antibody were cloned by restriction enzyme digest or Gibson Assembly (New England Biolabs) into pCMVR either individually or with a linker ...
-
bioRxiv - Neuroscience 2021Quote: ... with 3’-O-Me-m7GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at 8:1 to GTP for a capping efficiency of ∼90% ...
-
bioRxiv - Plant Biology 2019Quote: ... Lysates pre-cleared for 15 minutes with 50µl goat anti-rabbit magnetic beads (NEB). Pre-cleared lysates were then incubated with either goat anti-rabbit magnetic beads only (mock IP ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by detection of ubiquitinated substrate by immunoblotting using anti-MBP (New England Biolabs), anti-GST and anti-ubiquitin (Santa Cruz Biotechnology ...
-
bioRxiv - Molecular Biology 2023Quote: ... Rabbit polyclonal anti-SNAP-tag (Cat no. P9310S, New England Biolabs, 1:1000 dilution). Secondary antibodies used were ...
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were analyzed by SDS-PAGE and western blotting by using antibodies against MBP (1:1000, New England Biolabs, E8038S) or GST (1:1000 ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Microbiology 2022Quote: ... Around 100ng of the RNA was kept as input control and stored at -80°C whereas the remaining amount was subjected to immunoprecipitation using m6A specific antibody (NEB #E1610S). Initially ...
-
bioRxiv - Molecular Biology 2023Quote: ... m6A-immunoprecipitation (m6A-IP) were performed using the monoclonal m6A antibody from the EpiMark N6-Methyladenosine enrichment kit (NEB cat. E1610S). Input and eluted total RNA from m6A-IP were used to prepare libraries with Takara Pico-Input Strand-Specific Total RNA-seq for Illumina v2 (Takara) ...
-
bioRxiv - Plant Biology 2022Quote: ... the particles were captured by magnetic stand and proteins captured by the particles were separated by SDS-PAGE and examined by immunoblotting using MBP antibody (NEB, #E8032S). For the immunoblot ...
-
bioRxiv - Molecular Biology 2021Quote: ... a set of 5’-end biotinylated anti-sense DNA oligoes and 5ul RNase inhibitor (NEB) were added to the lysate ...
-
bioRxiv - Microbiology 2021Quote: ... The assay mixture was then analyzed using western blotting by anti-MBP (New England Biolabs) and anti-His (D2951 ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-Flag immobilized Mif2-6xHis-6xFlag was then treated with lambda-phosphatase (New England Biolabs) according to the manufacturer’s instruction and incubated for 2 h at 30 °C and 1200 rpm in a thermomixer ...
-
bioRxiv - Immunology 2020Quote: ... before being incubated with alkaline phosphatase-labeled anti-rabbit IgG (New England Biolabs, Beverly, MA).
-
bioRxiv - Biochemistry 2023Quote: ... The anti-Flag immunoprecipitates were subject to Lambda phosphatase treatment (NEB #P0753L, Ipswich, MA, USA).
-
bioRxiv - Plant Biology 2023Quote: ... followed by detection of the ubiquitinated substrate by immunoblotting using anti-MBP (New England Biolabs), anti-GST and anti-ubiquitin (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2020Quote: Small RNA libraries were prepared from the extracted 1ug total RNA or 100ng PIWIL1-antibody-pulled down RNA using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) (NEB, Cat# E7300S) according to the manufacture’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: Amino acid sequencing and glycan localization were carried out by digesting the antibody samples with trypsin or chymotrypsin (New England Biolabs, Ipswich, MA) followed by LC-MS/MS analysis of proteolytic fragments with an Orbitrap Fusion (Thermo ...
-
bioRxiv - Molecular Biology 2021Quote: ... pH 8.0) were incubated with pre-washed pan anti-Kbhb beads (PTM Biolabs Inc., Chicago, IL) at 4 °C overnight with gentle shaking ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment(anti-sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sense and anti-sense digoxigenin labeled probes were then produced using Taq polymerase (New England Biolabs) and 40 cycles of PCR with either the sense or anti-sense primer in a Taq polymerase PCR mixture to which 0.067 mM of Digoxigenin-5-aminoallyl-dUTP (Jena Bioscience GmbH ...
-
bioRxiv - Plant Biology 2020Quote: ... The elutes were separated by 12% SDS-PAGE and subjected to immunoblotting using anti-MBP (NEB) and anti-His (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... The assay mixture was then analyzed using western blotting by anti-PanKcr (PTM-501, PTM Biolabs) and anti-H3 (ab1791 ...
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: ... pH 8.0) were incubated with pre-washed pan anti-succinyllysine (PTM-104, PTM Biolabs, Hangzhou, China) conjugated agarose beads at 4°C overnight with gentle oscillation ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were blocked with 5% BSA in 1X PBS for 30 minutes at room temperature followed by subsequent incubation with primary antibodies against MBP (NEB E8032L, 1:200) and RAD51 (Proteintech 14961-1-AP ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were separated by SDS-PAGE and detected by immunoblotting using anti-MBP (New England BioLabs, E8032S), anti-GST (MBL ...
-
bioRxiv - Systems Biology 2023Quote: ... and the sense and anti-sense crRNA oligos were annealed and phosphorylated with T4 PNK (NEB, M0201). The linearized pRG212 vector and crRNA oligo were then ligated with T4 DNA Ligase (M0202).
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL phosphorylation mix (1µL 100mM sense oligo, 1µL 100mM anti-sense oligo, 0.5µL 25mM ATP (BioLabs #P0756S), 1µL 10X PNK T4 Buffer (BioLabs #B0201S) ...
-
bioRxiv - Plant Biology 2023Quote: ... a CP29A specific rabbit antisera (Kupsch et al., 2012) or anti-SNAP rabbit antisear (NEB, Frankfurt, Germany) in 1:2000 dilution overnight at 4°C and subsequently washed with TBST buffer four times at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... and the ubiquitinated ERECTA_CD were detected by IB analysis with anti-MBP (E8032, 1:10,000, New England Biolabs) as primary antibody ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein amounts of OP18 and beta-actin were quantified using a primary stathmin polyclonal antibody (1:1000; Cell Signaling Technology, NEB GmbH, Frankfurt/Main, Germany) and a polyclonal beta-actin antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment (sense/anti-sense) Pceh-23_L::acy-2 fragment(sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2019Quote: ... the purified C-I30-Flag protein (30µl beads) was digested on beads (Anti-FLAG M2 affinity gel) with final 5U Enterokinase (cat#: P8070S, NEB) in the 1x EK reaction buffer (20 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... the purified C-I30-Flag protein (30µl beads) was digested on beads (Anti-FLAG M2 affinity gel) with final 10U CIP Phosphatase (cat#: M0290S, NEB) in the 1x CIP buffer (50 mM Potassium Acetate ...
-
bioRxiv - Developmental Biology 2021Quote: ... Positive clones were digested with the appropriate enzyme to linearize the plasmid and anti-sense ribonucleoprobe synthesis was carried out using Sp6 or T7 RNA polymerase (New England Biolabs)+DIG labeled UTP (Roche) ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were gel-purified and quantitated and then used to make digoxigenin-labeled anti-sense probes using single primer PCR with Taq polymerase (New England Biolabs) in which a third of the dTTP had been replaced with Digoxigenin-X-(5-aminoallyl)-2’-deoxyuridine-5’-triphosphate (Jena Bioscience ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA used in this study was capped with either m7G (Anti-Reverse Cap Analog [ARCA], S1411L) or ApppG cap analog (S1406S, New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... Bleo-treated WT-PNKP-FLAG and K226R-PNKP-FLAG cells using 10 μg of custom-made rabbit polyclonal anti-AcK226 Abs (Ez Biolabs). All other subsequent steps and buffers used for IP were the same as described earlier (17,18) ...
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was synthesized as described (Schäfer et al., 2018) in the presence of anti-reverse cap analog (NEB or Jena Biosciences) and gel-purified ...