Labshake search
Citations for New England Biolabs :
201 - 250 of 370 citations for Mouse Anti Giardia Lamblia Trophozoite Antibody G18 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... anti-H3K18la (PTM BIOLABS, PTM1406, 1:1000), and anti-H4K12la (PTM BIOLABS ...
-
bioRxiv - Biochemistry 2023Quote: ... and Anti-MBP (NEB E8032S, 1:10000). Secondary antibodies include IRDye 680RD goat anti-rabbit (LI-COR 926-68071 ...
-
bioRxiv - Genetics 2023Quote: ... and anti-rabbit HRP conjugated (NEB #7074) and anti-mouse HRP conjugated (Cell Signaling Technologies #7076 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-H3K9la (PTM BIOLABS, PTM1419RM, 1:1000), anti-H3K14la (PTM BIOLABS ...
-
bioRxiv - Cancer Biology 2021Quote: ... The membrane was incubated with HRP-conjugated secondary antibodies (1:5000, NEB) for 45 mins at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP-conjugated antibody binding was detected using TMB substrate (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... CREB (CCDS15005.1) and CRTC1 (CCDS40372.1) were amplified from mouse brain cDNA library by primers contain AgeI-HF (R3552L, NEB) and BamHI-HF (R3136L ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... mCapH2 (Gene ID: 52683) genes were PCR amplified from human and mouse genomic DNA with Q5 polymerase (NEB). The lengths of homology arms are featured in electronic supplementary material Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Neuroscience 2024Quote: Mouse Hapln1 (NM_013500) was cloned into the pAAV vector by PCR with the following primers and ligase (NEB) or In-Fusion cloning (Takara) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatants were immunoprecipitated overnight with 40 µL of precoated anti-IgG magnetic beads (goat anti-rabbit IgG magnetic beads, NEB) previously incubated with the antibody of interest for 4 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primary antibodies used were from Cell Signalling Technologies (New England BioLabs, ON, CAN). They included phosphorylated and total extracellular signal-regulated kinase (P-ERK 1/2 ...
-
bioRxiv - Biochemistry 2022Quote: The plasmid CM13d3 (Antibody Design Labs) was digested with SacI (New England Biolabs) for 10 hours at 37 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... or anti-H3K9bhb (PTM Biolabs cat # PTM-1250) diluted 1:2,000 in blocking solution ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SNAP-tag (P9310, New England BioLabs), rabbit anti-beta-tubulin (NB600-936 ...
-
bioRxiv - Cell Biology 2020Quote: ... Pan anti-trimethyllysine (rabbit, PTM Biolabs, PTM-601), SETD2 (rabbit ...
-
bioRxiv - Cell Biology 2019Quote: ... or rabbit anti-GAPDH (2118S NEB, 1:5000) primary antibody with horseradish peroxidase-conjugated anti-mouse or anti-rabbit (Dianova 1:10,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-insulin was from Sigma (I-2018) and anti-SNAP from NEB (P9310S). The coverslips were mounted on glass slides with VectaShield Antifade Mounting Medium and fixed with nail polish ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-Gaussia luciferase (E8023, New England Biolabs) at a 1:2,000 dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-malonyl-lysine (PTM Biolabs, Cat. #PTM-901), anti-succinyl-lysine (PTM Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... and pan anti-acetyllysine (PTM-105, PTM Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... anti-glutaryl-lysine (PTM Biolabs, Cat. #PTM-1151), anti-ACC (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-succinyl-lysine (PTM Biolabs, Cat. # PTM-401), anti-glutaryl-lysine (PTM Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-H4K12la (PTM BIOLABS, 1:1000, PTM1411RM). The next day ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-succinyllysine (PTM Biolabs, PTM-401, 1:1000), anti-MYC (and anti-SUCLG2 (Bethyl Laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit, NEB). Detailed sub-cloning information is available upon request.
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: Specific antibodies against Slug (C19G7, Cell Signaling Technology, NEB, Frankfurt, Germany, #9585, 1:400), pan-cytokeratine (polyclonal ...
-
bioRxiv - Immunology 2022Quote: ... As an isotype control an unspecific polyclonal rabbit antibody was used (NEB, Frankfurt, Germany). To block ORF8 during differentiation it was preincubated with the polyclonal rabbit anti-ORF8 antibody or isotype over night and added to the monocytes (t=0 ...
-
bioRxiv - Microbiology 2021Quote: ... plates were immunostained using a monoclonal antibody against SARS-CoV2 nucleoprotein (Creative-Biolabs; NP1C7C7) at a dilution of 1:1000 followed by 1:5000 anti-mouse IgG monoclonal antibody and was developed using KPL TrueBlue peroxidase substrate for 10 minutes (Seracare ...
-
bioRxiv - Cancer Biology 2020Quote: ... and murine lung slices were incubated overnight with primary antibodies in 0.1% BSA as follows: anti-CDH1 (clone EP700Y, Biozol, 1:250) or anti-CDH1-Alexa-488 (clone 24E10, New England Biolabs, 1:50), anti-Twist1 (clone Twist2C1a ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated with mouse anti-CaMKIIα (6G9) (1:1000, Pierce Biotechnology, Catalog #MA1-048) and rabbit anti-Gaussia luciferase (1:1000, New England BioLabs, Catalog #E8023S) overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...