Labshake search
Citations for New England Biolabs :
101 - 150 of 5167 citations for Mouse Anti Dengue Virus Envelope Protein Serotypes 1 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse α-myc (New England Biolabs, clone 9B11, 1:2,000), rabbit α-pol-I largest subunit 15 (1:100 ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Virus stocks were generated by either transfecting purified in vitro transcribed viral RNA (HiScribe, NEB) or transfecting the infectious cDNA clone containing plasmid in BHK-T7 cells ...
-
bioRxiv - Biochemistry 2023Quote: Infection in HCT116: Cells were infected with virus and 8 μg/mL polybrene (NEB, #H9268).
-
bioRxiv - Cell Biology 2024Quote: ... RNA was reverse transcribed with Moloney murine leukemia virus (M-MuLV) transcriptase (New England Biolabs). The purity and concentration of RNA were measured using NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Molecular Biology 2020Quote: ... antibody were incubated with 25 µL of magnetic anti-mouse beads (NEB) overnight ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 µM NGFR121W-SNAP was coupled with 3 µM BG549 surface (NEB # S9112) for 1 hour at 37°C in calcium imaging (CIB ...
-
bioRxiv - Genomics 2022Quote: ... We ligated a 3’ adapter ligation using T4 RNA Ligase 1 (NEB, M0204L). We performed a second bead binding followed by a 5’ decapping with RppH (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Neuroscience 2022Quote: ... so the bead-bound proteins were dephosphorylated in wash buffer containing 1:50 Lambda Protein Phosphatase (New England Biolabs) and 1 mM MnCl2 to make the phosphosites more accessible for a kinase assay ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Synthetic Biology 2021Quote: 8.3 μM bdSUMO-HSPB611–20 fusion protein containing pSer or nhpSer at site S16 of HSPB6 were reacted with 3 units of λ phosphatase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µl of lambda protein phosphatase (New England BioLabs, Ipswich, MA). Each mixture was incubated at 30 °C for either 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μl of Lambda protein phosphatase (P0753L, New England BioLabs) were incubated with the proteins at 30°C for 30 minutes.
-
bioRxiv - Plant Biology 2023Quote: ... MBP-tagged and GST-tagged proteins were detected using anti-MBP (E8032S, NEB) and anti-GST antibody (60-021 ...
-
bioRxiv - Microbiology 2023Quote: ... cell and virus particle lysates were treated with PNGase F and Endo Hf (New England Biolabs) following the manufacturer’s protocol for 1 hour at 37°C prior to Western blotting.
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM MnCl2 only or together with 1 μl Lambda Protein Phosphatase (New England Biolabs). After incubation at 30°C for 30 min ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-mouse IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) were used as the secondary antibodies.
-
bioRxiv - Genomics 2020Quote: ... and followed by incubation with 3 μl (1 U/μl) of USER enzyme (NEB) at 37°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... and ligated at a 3:1 amplicon:plasmid ratio with t4 DNA ligase (NEB, US) overnight at 16°C ...
-
bioRxiv - Genetics 2020Quote: ... remaining ssDNA oligonucleotides were digested by the addition of 3 μL exonuclease 1 (NEB) to 20 μL extracted DNA ...
-
bioRxiv - Genomics 2019Quote: ... in 1× Buffer 3 (Bionano Genomics) or 120 U of Nb.BssSI (New England Biolabs) in 1× NEBuffer 3.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... these products were ligated to a 3’ adapter (1× T4 RNA ligase buffer (NEB), 10% PEG-8000 ...
-
bioRxiv - Plant Biology 2024Quote: ... was used for Level 1 and 3 assembly and SapI (New England BioLabs, USA) for Level 2 assembly ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Genetics 2021Quote: ... 1 ul of 20 μM Cas protein (SpyCas9 and SauCas9 from NEB; Nme2Cas9 was purified as previously described (Edraki et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 pmol of the oligonucleotides 5’-ATTGTCATACCGATCCCAATTCGA-3’ and 5’-AAACTCGAATTGGGATCGGTATGAC-3’ were phosphorylated for 30 min at 37 °C using 1 mM ATP and 1 unit polynucleotide kinase (NEB) in the buffer supplied by the manufacturer and then hybridized in a thermocycler (5 min 95 °C ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Genomics 2021Quote: ... 1 μl of RNAse inhibitor and 3 μl of Antarctic phosphatase (New England BioLabs Inc.). We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Genomics 2021Quote: ... The 3′ adapter (sequence: AGATCG-GAAGAGCACACGTCTGAACTC) was ligated using T4 RNA Ligase 1 (NEB, M0204L) and purified nascent RNA using streptavidin beads (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Systems Biology 2019Quote: ... the Nickel-NTA beads were incubated in 80 μl 3’-linker ligation mix with (1 X PNK buffer, 1 µM 3’-adapter, 10% PEG8000, 30U Truncated T4 RNA ligase 2 K227Q (NEB, M0351L), 60U RNasin) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... 1-20 μg of the Env protein was mixed with 1 μl of Glycoprotein Denaturing Buffer (NEB, 10×) and H2O (if necessary ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Systems Biology 2020Quote: ... MnCl2 to a concentration of 1 mM and NEBuffer for Protein MetalloPhosphatases (NEB) diluted to a 1X concentration were added to both tubes ...