Labshake search
Citations for New England Biolabs :
401 - 406 of 406 citations for Mouse Anti Cytomegalovirus Phosphoprotein 65 Antibody 0885 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... sgRNA-hKCTD5 sense CACCGCGAGCTCCTGTCGCCGGCC and sgRNA-hKCTD5 anti-sense AAACGGCCGGCGACAGGAGCTCGC followed by phosphorylation of the double-stranded DNA by T4 kinase (NEB). The sgRNA was cloned into pX330 (a generous gift from S ...
-
bioRxiv - Molecular Biology 2024Quote: ... the reaction was started in the absence of GTP and in the presence of 0.5 mM of anti-reverse m7G-cap analog (NEB #S1411) for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was synthesized as described (Schäfer et al., 2018) in the presence of anti-reverse cap analog (NEB or Jena Biosciences) and gel-purified ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was transcribed into mRNA which was co-transcriptionally capped with the Anti-Reverse Cap Analog (ARCA) 3′-O-Me-m7G(5′)ppp(5′)G (NEB # S1411) using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies were diluted in the same Triton X 100 and BSA solution and suppliers and source were: primary 1:200 anti-CK20 rabbit D9Z1Z (New England Biolabs, Herts, UK), anti-CD31 mouse JC70/A (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... The RNAs were co-transcriptionally capped with m7G anti-reverse cap analog or ApppG Cap Analog (New England Biolabs, 1411 and Cat#1406). The RNAs were purified using a Purelink RNA Mini Kit (Thermo Fisher Scientific ...