Labshake search
Citations for New England Biolabs :
1 - 50 of 388 citations for Mouse Anti Cytomegalovirus Phosphoprotein 28 Antibody 0898 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Maltose Binding Protein monoclonal antibody IgG2a (New England Biolabs), mouse anti-Histone H3 [Trimethyl Lys9] 6F12-H4 (Novus Biologicals) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Molecular Biology 2020Quote: ... antibody were incubated with 25 µL of magnetic anti-mouse beads (NEB) overnight ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... +28 μl M.EcoGII at 5 U/μl (NEB M0603S). The DNA was purified using Qiagen PCR columns and quantified by measuring A260 ...
-
bioRxiv - Genomics 2023Quote: ... (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3 ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Cell Biology 2019Quote: ... then incubated with either mouse anti-MBP antibodies at a dilution of 1:5000 (New England Biolabs) or 1:2500 mouse anti-GFP antibodies (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... 28 μl 10 x NEB DpnII buffer and 500 units of DpnII (NEB, R0543M) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... 28 novel RNF43 RING domain variants were generated using Q5 mutagenesis (New England Biolabs). All ZNRF3 and RNF43 expression plasmids were full-length sequence verified ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary mouse antibodies against MBP (NEB E8032L, 1:5000) and RAD51 (Novus Biologicals 14b4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... antibody and anti-Gluc antibody (New England Biolabs, ref. E8023).
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-PPARα (1:25, Arigo Biolabs ARG55240). Alexa Fluor conjugated secondary antibodies (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2021Quote: A standard 28 base methylated hairpin oligonucleotide (CTGCCAGGATCTTTTTTGATCCTGGCAG) is provided by the manufacturer (New England Biolabs) at 15 µM ...
-
bioRxiv - Plant Biology 2021Quote: ... Anti-MBP murin monoclonal antibody (Biolabs) was immobilized (around 11000 responsive units (RU) ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-Kcr antibody (PTM Biolabs, PTM502), anti-Ub antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA (28) using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (sTable 5) ...
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... anti-MBP mouse 1/80,000 (E8032S, New England Biolabs). Western Blots were quantified using Fiji ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-myc (NEB/Cell Signaling, 2276; 1:1500) o/n at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti Pan-Keratin (clone C11, NEB, 4545S). Primary antibodies were incubated with sections overnight at 4°C except for anti-CD3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were detected using anti-MBP antibody (anti-MBP NEB e8032s) and HRP conjugated secondary antibody ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-lactyllysine antibody (PTM Biolabs), or mouse monoclonal anti-β-actin antibody (A5316 ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-butyryllysine antibody (PTM BioLabs, PTM#301) at 1:2000 dilution was incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Evolutionary Biology 2022Quote: The DMRT regulatory region was amplified from the DMRT>GFP plasmid [28] using Phusion polymerase (New England Biolabs) with primers ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were stained with mouse anti-MBP (NEB, 1:500), followed by washing and subsequent incubation with goat anti-mouse IgG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were stained with mouse anti-MBP (NEB, 1:500), followed by washing and subsequent incubation with goat anti-mouse IgG ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... were generated from previously described pcDNA3-FLAG-MS2-TTP plasmids (28) using site-directed mutagenesis according to manufacturer’s protocol (New England Biolabs). Expression plasmids for FLAG-tagged constitutive active and catalytically dead MK2 kinases were previously described (12 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and anti-MBP antibody (NEB E8032L; 1:10,000) in 1x TBST supplemented with 5% low-fat milk were incubated either at 4 °C overnight or 1 hr at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... It has been generated by PCR amplification from the pCTCF-GFP vector (28) and sub cloned into the pHalo-GR previously cut with PvuI and XhoI restriction enzymes (New England Biolabs). The pHalo-SMARCA4 was purchased from Promega (pFN21AE0798) ...
-
bioRxiv - Biochemistry 2019Quote: ... The pellet was resuspended in 28 µl hypertonic buffer and incubated at room temperature for 15 min with 1000 gel units of micrococcal nuclease (NEB). Chromatin-bound proteins were released from the DNA by addition of 7 µl of 1 M ammonium sulfate on ice for 5 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... The EC3-5 domains were created by deleting amino acids 28-262 for PCDH15 and 25-228 for CDH23 using site-directed mutagenesis (New England Biolabs). This strategy preserved the native signal peptide sequence ...
-
bioRxiv - Biochemistry 2019Quote: ... In the case of Biotinylated-AviTag-haBiP(28-635)T229A-V461F this protein was also made nucleotide free by the addition of 2 U CIP (NEB) per mg of BiP ...
-
bioRxiv - Cancer Biology 2022Quote: Codon-optimized sequences encoding the DNA-binding domains of human BATF (AA 28-87) and JUNB (AA 269-329) were cloned into pMAL-C2X (NEB). The sequence encoding human IRF4 DBD (AA 19-120 ...
-
bioRxiv - Cell Biology 2023Quote: ... was introduced into an existing pZDonor-AAVS1-CAG-HA-KLF1-ERT2-PolyA plasmid (28) via site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and detected using anti-MBP antibodies (New England Biolabs).