Labshake search
Citations for New England Biolabs :
351 - 400 of 3655 citations for Mouse Anti Canine Distemper Virus Surface Envelope Antibody 8 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... anti-MBP (1:10,000, catalog no. E8032S, New England Biolabs); anti-CCNA2 (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-GFP (1:1000; TP401, Torrey Pine Biolabs, RRID:AB_10013661), mouse anti-GFP (1:1000 ...
-
bioRxiv - Plant Biology 2022Quote: ... Gel blots were analysed using anti-MBP (NEB, 1:10.000) and anti-GST antibodies (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-L-lactyllysine (pan-Kla, PTM BIOLABS, PTM1401, 1:1000), anti-H3K9la (PTM BIOLABS ...
-
bioRxiv - Biochemistry 2020Quote: ... then extended and inserted into pCS2+8 or pET28a linearized with EcoRI (NEB). All inserts were fully sequenced by Sanger sequencing at the Cornell Genomics Core Facility.
-
bioRxiv - Biochemistry 2019Quote: ... Peak fractions were pooled and passed over an 8 mL amylose column (NEB), washed with 5 CV of Amylose Wash Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Genetics 2019Quote: ... and 5 U/µl DNA polymerase I Klenow (8 µl; New England Biolabs), and incubated for 90 min at 37°C with rotation ...
-
bioRxiv - Genomics 2020Quote: ... 15 mM HEPES pH 8) and 20 μl of DNase I (M0303S, NEB). The Nuclease Flushing mix was loaded into the flow cell and incubated for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were then successively treated with 8 U/mL DNase I (NEB; M0303S) for 5 min at 37°C and 4 U/mL RNase I for 3 min at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... 2 μM X4L4 or 8 U/μL T4 DNA ligase (New England BioLabs) and an increasing amount of PEG 8k (w/v ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were incubated with 200 nM SNAP-Surface® Alexa Fluor® 488 (New England Biolabs, UK, diluted in serum-free DMEM/F12), for 30 min at 37°C with 5% CO2 ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercial antibodies used in this study are Pan anti-butyryllysine (PTM Biolabs, SKU: PTM 301), Butyryl-Histone H4 (Lys 12 ...
-
Systematic Analysis of Lysine Succinylation in Vero cells infected with Small Ruminant MorbillivirusbioRxiv - Genomics 2021Quote: Lysine-succinylated peptides were enriched using agarose-conjugated pan anti-succinyllysine antibody (PTM Biolabs, Hangzhou, China). In brief ...
-
bioRxiv - Neuroscience 2021Quote: ... 8 μg of DNA were treated with 30 U of RNase H (NEB, M0297) for 16 h at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... and 8 μL of 5U/μL DNA Polymerase I Large (Klenow) Fragment (NEB M0210). The reaction was the incubated at 37°C in a Thermomixer at 900 rpm for 45 minutes.
-
bioRxiv - Genomics 2021Quote: ➢ Distinct from currently used length 8 barcodes from common library kits (Illumina TruSeq, NEB)
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μg bovine serum albumin (BSA) and 8 units Phi29 DNA polymerase enzyme (NEB). Amplification reactions were monitored for 5 hours at 30 °C in MicroAmp fast reaction tubes with cap (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 200 μM dNTPs and 8 units of Bst 2.0 warmstart DNA polymerase (NEB) were added and reaction was incubated at 65°C for 2 minutes ...
-
bioRxiv - Genomics 2023Quote: ... and 8 μL of 5U/μL DNA Polymerase I Large (Klenow) Fragment (NEB #M0210). The reaction was the incubated at 37 °C in a Thermomixer at 900 rpm for 45 minutes.
-
bioRxiv - Cancer Biology 2020Quote: Specific antibodies against Slug (C19G7, Cell Signaling Technology, NEB, Frankfurt, Germany, #9585, 1:400), pan-cytokeratine (polyclonal ...
-
bioRxiv - Microbiology 2022Quote: ... goat polyclonal anti-UIS4 (LS Biolabs LS-C204260; IFA 1:1000); rabbit polyclonal anti-LISP2 (IFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and probed with either anti-histone H3 (1:1000, NEB, 9715S) or anti-histone H3 (phosphor S10 ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were washed three times with a PBS buffer 1X and then incubated with mouse anti-MBP (NEB, Cat# E8032L) or rabbit anti-V5 (Cell Signaling Technology ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 U of Bst DNA polymerase (large fragment; New England Biolabs Inc., Beverly, MA, USA), 1x of the supplied buffer and a variable amount of DNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... then immediately mixed with 8 μL NEBNext Second Strand Synthesis Reaction Buffer (New England Biolabs), 4 μL NEBNext Second Strand Synthesis Enzyme Mix (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... Truncated ric-8 constructs were generated by PCR using high-fidelity Phusion DNA polymerase (NEB). Phosphorylation mutants were created using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... For the ligation reaction 8 µL of the digest was treated with T4 Ligase (NEB) for 16 hours at 16 °C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and anti-Phospho-histone H3 1:100 (New England Biolabs, Ipswich, USA) and secondary antibodies AlexaFluorTM 488 goat anti-chicken and AlexaFluorTM 594 goat anti-rabbit IgG (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-SNAP (1:1000, polyclonal, New England Biolabs, Ipswich, MA, P9310S), or mouse anti-tubulin (1:40,000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... overnight at 4°C followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification (8-9 cycles) was performed with 10 μL Fusion HF Buffer (New England Biolabs), 3.125 μL 10uM TruSeq Primer 1 ...
-
bioRxiv - Microbiology 2019Quote: ... and PCR enrichment (8 cycles) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, Ipswich, MA). DNA concentrations were estimated using qPCR and the Kapa Library Quant Kit (Kapa Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgRNA.SFFV.RFP657 (sgRNA only for Cbl intron 7/8 targeting) using T4 DNA ligase (NEB, M0202S) (57) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6-8 µg of Cas9-mSA plasmid was linearized by Not1-HF restriction enzyme (NEB #R3189S). The 8.8kb linearized fragment was cut out from a 1.5% agarose gel and DNA was extracted using QIAquick Gel Extraction Kit (Qiagen #28115) ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA (200 ng) was digested with 8 U of high-fidelity ApekI (New England Biolabs, USA) at 75 °C for 2 h.
-
bioRxiv - Genomics 2019Quote: ... 20 ng of the forward backbone was amplified with Len_lib_linF and Len_lib_linR (Supplemental Table 8) using NEBNext High-Fidelity 2X PCR Master Mix (NEB); the minimal promoter and GFP was amplified from 10 ng of the pLS-mP plasmid using minGFP_Len_HAF and minGFP_Len_HAR (Supplemental Table 8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.8 M guanidine HCl) containing 8 units/ml and Proteinase K (P8107S, New England Biolabs Inc.) was added freshly to the digestion buffer ...
-
bioRxiv - Genomics 2020Quote: ... each sample(8 μl) was mixed with 12.5 μl 2X Quick Ligation buffer (New England BioLabs), 2.5μL T4 DNA ligase (2000U/μL ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... m6A pulldown was performed with a rabbit monoclonal anti-m6A antibody in the EpiMark N6-Methyladenosine Enrichment Kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: PCR was performed on toe clippings that were incubated overnight at 55° C in tail lysis buffer (10mM Tris pH 8, 0.4M NaCl, 2mM EDTA, 0.1% SDS, 3.6U/mL Proteinase K (NEB)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 8 μL of the de-phosphorylated DNA was incubated with 2 μL T4 Polynucleotide Kinase (NEB M0203S), 3 μL γ32P-dATP (Perkin Elmer) ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: GBL phosphate (8) was incubated with 5 units of calf intestinal alkaline phosphatase (CIP, New England Biolabs) in 50 mM HEPES buffer (pH 8.0 ...