Labshake search
Citations for New England Biolabs :
551 - 600 of 10000+ citations for Mouse Acrosomal Protein SP 10 ACRV1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... and 10 U T4 RNA Ligase1 (NEB). Reaction mixtures were incubated at 37°C for 2.5 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 mM DTT (New England BioLabs), and centrifugated at 20,000 g for 2 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of enzyme (NEB, cat# R0543) was used in a 50 μl-reaction containing 5 μl of NEBuffer r3.1 (10X ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10-beta cells (New England Biolabs) with 5 μl of the assembly mix according to the protocol provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 10 units T4 PNK enzyme (NEB) at 37 °C for 30 min.
-
bioRxiv - Genomics 2022Quote: ... 10 µL 25U/µL MboI (NEB, #R0147L) and 5 µL water were added to each tube and incubate at 37°C with rotation for 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 µl of 10× CutSmart buffer (NEB), 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei ...
-
bioRxiv - Bioengineering 2023Quote: ... Escherichia coli 10-beta (New England Biolabs) was used for plasmid construction ...
-
bioRxiv - Bioengineering 2023Quote: ... NEB 10-beta (NEB cat. no. C3019), or NEB Stable (NEB cat ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 U/mL of DNaseI (NEB, M0303S), 1x cOmplete™ protease inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2023Quote: ... 10 units of restriction enzyme XhoI (NEB) were added to the nucleosome array with and without PU.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RP1 primer (NEB), 1 µL ddH2O and PCR amplified for 16-18 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RPI primer (NEB), 2 µL 10 µM RP1 primer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10×T4 ligase buffer (NEB), 0.2 μl 0.1 M ATP (Thermo Fisher) ...
-
bioRxiv - Genomics 2023Quote: ... restriction enzyme (10 units of HpyCH4IV [NEB] for PCR7 and PCR31 ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
bioRxiv - Neuroscience 2023Quote: ... in 1:10 CutSmart Buffer (BioLabs #B6004S) at 37°C for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 U of T7 endonuclease I (NEB) was added and incubated for 15 min at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Scaffold strands (10 nM, M13mp18, Bayou Biolabs) were mixed with staple strands (100 nM ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 units of RNaseH (New England Biolabs) were added to the mix and allowed to digest at 37°C for 1 h ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µL HiFi 2X Master Mix (NEB), and water up to 20 µL ...
-
bioRxiv - Synthetic Biology 2023Quote: Restriction endonuclease BsaI (10 U/μL) (NEB), supplied with 10x NEB Buffer.
-
bioRxiv - Genomics 2023Quote: ... 10 μl Large Klenow Fragment (NEB #M0210L) was added and the chromatin is incubated for 15 min at 37°C with shaking ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB, S1402S)) and incubated overnight at 37°C in a humidified chamber ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Biophysics 2024Quote: ... 10 units of calf intestinal phosphatase (NEB), 5 units of antarctic phosphatase (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... The E1371Q samples were phosphorylated using protein kinase A (NEB). The wild-type sample was de-phosphorylated using λ-phosphatase ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 µl 10x buffer for Protein MetalloPhosphatases (New England Biolabs), and 5 µl 10 mM MnCl2 for 30 min at 30 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins associated to chromatin (pellet) were treated with DNaseI (NEB). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... both proteins were deglycosylated by PNGase F (NEB, 1:50) overnight at 37°C in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... A slurry of protein A or G magnetic beads (NEB) was used to capture enriched chromatin ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested using 4µl Proteinase K (800U/ml, NEB) and incubation at 55°C for 2h ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The protein was digested with PNGase F (New England BioLabs) under denaturating conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... The protein was purified on amylose resin beads (E8021S, NEB) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Fusion proteins were purified in batch by amylose affinity (NEB), eluting in buffer B (buffer A with 0.02% DDM ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein/lysate sample de-N-glycosylation using PNGase F (NEB), Endo S (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... Eluted protein samples flowed through Amylose resin (New England Biolabs) for a second step of affinity purification ...
-
bioRxiv - Neuroscience 2020Quote: ... Ca2+/calmodulin-dependent protein kinase II (CaMKII, New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... Blue Protein Standard Broad Range (New England Biolabs, Hitchin, UK) was used as a protein marker ...
-
bioRxiv - Cell Biology 2020Quote: ... 75 µl of protein G magnetic bead suspension (S1430, NEB) pre-equilibrated in lysis buffer was added to each tube and incubation continued for additional 1 h at +4□C ...
-
bioRxiv - Biophysics 2022Quote: ... Fusion proteins were purified in batch by amylose affinity (NEB), eluting in buffer B (buffer A with 0.02% DDM ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified GST-fusion proteins were incubated with CK2 enzyme (NEB) in 20μl kinase buffer (20mM Tris-HCI [pH 7.5] ...
-
bioRxiv - Molecular Biology 2022Quote: ... recombinant kinases (2500 U/mg protein for PKA (NEB-P600S), 500:1 Tau:kinase for Gsk3ß (BPS-40007) ...
-
bioRxiv - Molecular Biology 2022Quote: ... O-glycosidase (New England Biolabs, 20 000 U/μg protein), α2-3,6,8 neuraminidase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... α2-3,6,8 neuraminidase (New England Biolabs, 25 U/μg protein) and α-N-acetyl-galactosaminidase (New England Biolabs ...