Labshake search
Citations for New England Biolabs :
351 - 400 of 4925 citations for Mono 2 Ethyl 5 Carboxypentyl Phthalate Unlab. Dehp Metabolite V ;100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Plant Biology 2023Quote: ... Type-IIS cloning was performed as described previously (Cai et al., 2020) using a Master Mix containing 10% (v/v) 10× T4 DNA ligase buffer (NEB #M0202), 2.5% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... excess gel was removed and embedded specimen were placed in digestion buffer (1X TAE, 0.5% Triton X-100, 0.8 M guanide HCL) with 8 units/ml Proteinase K (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2.5μL of 20% Triton X-100, 1μL BSA (100x, 10mg/mL) and 10μL HaeIII (10U/μL, NEB, R0108S) with shaking at 37°C overnight ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... resuspended purified nuclei were incubated with 1 mM CaCl2 and 100 ku/ml micrococcal nuclease (New England Biolabs) in HB for 37°C for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were harvested 3 days after electroporation and genomic DNA was extracted with 100 μL lysis buffer (10 mM Tris-HCl, pH 7.5, 0.05% SDS, 25 μg/mL proteinase K (NEB)) at 37 °C with incubation for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... the samples were washed three times for 5’ each with PBS-0.01%Tween and incubated with 0.24 mg/ml Monarch RNase A (New England Biolabs) for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... cell lysates were adjusted to the same protein concentration using furin cleavage buffer (100 mM Tris-HCL and 1mM CaCl2) and incubated with 5 units of Furin (NEB, Ipswich, MA) for 16 h at 30℃ ...
-
bioRxiv - Biochemistry 2019Quote: ... and concentrated to 2 mg/mL and incubated with 3125 Units of Endoglycosidase H (Endo H)(NEB) per milligram of protein for 3 hours at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... The beads were drained of all liquids before 2 mg/ml of Proteinase K (New England Biolabs) diluted in PK buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2024Quote: ... and 2 µL of 2000 U/mL DNase I to the IVT reaction mixture (New England Biolabs). Template DNA digestion was carried out at 37 °C for 30 minutes in a thermocycler block prior to purification of the RNA using a Monarch RNA Cleanup Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plug was equilibrated with 100 μl CutSmart buffer containing 5 mM DTT and 1 mM dATP for 1 hour at room temperature before incubation for 2 h at 37°C in another 100 μl of the same buffer containing 1 μl Klenow exo-(NEB M0212S) and 1 μl T4 PNK (NEB M0201S) ...
-
bioRxiv - Neuroscience 2019Quote: ... Fixed neurons were then permeabilized and blocked simultaneously (2% normal goat serum, 5425S, New England Biolabs, and 0.1% Triton X-100) before incubation in primary antibody solutions overnight and subsequent incubation with secondary antibodies the following day.
-
bioRxiv - Genomics 2021Quote: Restriction digestion was carried out by adding 25 μL of 10 ×NEBuffer 2 and 100 U of the MluCI restriction enzyme (NEB, R0538) and incubating for ≥2 hours at 37°C in a Thermomixer at 900 rpm ...
-
bioRxiv - Zoology 2021Quote: ... amplicons were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA). Expected PCR product sizes of the first step and nested PCR step were 514 and 148 bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Neuroscience 2023Quote: ... Final nuclear lysates were resuspended using 100 µl of resuspension solution (1x PBS + 2% BSA + 0.2U/µl RNase inhibitor - New England Biolabs, Cat#: M0314S). Hoechst staining was performed to assess the quality of isolated nuclei based on their shape ...
-
bioRxiv - Biophysics 2023Quote: Tau was phosphorylated in vitro according to previous protocols with some modifications.12,88 50 µL of 100 µM tau was incubated with 2 µg cAMP-dependent Protein Kinase (PKA, New England BioLabs P6000S) and/or 0.4 µg GSK3β (Sigma-Aldrich G4296 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ABE reactions were treated with Endonuclease V (NEB) for 30 min at 37 °C in a 20 µL reaction ...
-
bioRxiv - Genetics 2023Quote: ... and successively digested with Exonuclease V (RecBCD, NEB M0345) at 37°C for 3 h ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We isolated poly-adenylated RNA from 1 ug of total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490) and constructed sequencing libraries with the NEBNext Ultra II RNA Library Prep kit (NEB #E7770 ...
-
bioRxiv - Bioengineering 2019Quote: ... All BACs except DHFR BAC derived BACs were linearized before transfection: 2207K13-UG BAC with SgrAI (New England Biolabs, Cat. # R0603S), HBB-UG BAC with NotI (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were next resuspended in 1X Thermo Pol Buffer and treated with 2 µL RNA 5’ Pyrophosphohydrolase (New England Biolabs M0356) at 37°C for 1 h to promote decapping of 5’ RNA ends ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Biochemistry 2020Quote: ... and m7G(5′)ppp(5′)A (NEB, #S1405S) also referred throughout the manuscript as N7-meGpppG and N7-meGpppA for consistency ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL RNase H (5 U/µL, NEB), 2.5 µL RNase III (1 U/µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Microbiology 2021Quote: Protein samples were generated by collecting the pellet for 1 ml of cells at OD600 ∼ 1.0 and lysing with 100 µl 1X SDS sample buffer (New England Biolabs) and DTT by boiling for 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 1× CutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate,100 μg/mL BSA, pH 7.9, NEB), 20 U RiboLock ...
-
bioRxiv - Microbiology 2021Quote: ... the inserts and the plasmids were mixed with Gibson master mix 2x (100 µL 5X ISO Buffer, 0.2 µL 10,000 U/mL T5 exonuclease (NEB #M0363S), 6.25 µL 2,000 U/mL Phusion HF polymerase (NEB #M0530S) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µL 100 µM dNTPs, 0.3 µL 50 mg/mL BSA, 6 µL blunting enzyme mix from quick blunting kit, NEB). Prior to ligation ...
-
bioRxiv - Genomics 2024Quote: ... 500 µl lysed cells were then transferred to a tube containing 4.5 ml digestion buffer (1% Triton X-100, 1x CutSmart buffer (New England Biolabs)) ...