Labshake search
Citations for New England Biolabs :
651 - 700 of 4925 citations for Mono 2 Ethyl 5 Carboxypentyl Phthalate Unlab. Dehp Metabolite V ;100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL 50% glycerol ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL High GC Enhancer (NEB), 0.5 μL 10 mM dNTPs ...
-
bioRxiv - Systems Biology 2023Quote: ... 5 μL Q5 Reaction Buffer (NEB), 5 μL High GC Enhancer (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 5 µl 10x CutSmart buffer (NEB), 1 µl PsiI enzyme (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... 5 uL 5X Phusion Buffer (NEB), 10 uL 1M Trehalose (Life Sciences Advanced Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL 5′deadenylase (NEB #M0331S), 1 µL of RiboLock (ThermoFisher #EO0381 ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer ...
-
bioRxiv - Genomics 2023Quote: ... or 5 U MboI (NEB R0147S) in 15 μl rCS buffer for 1 h at 37°C and analysed in a 1.2% agarose gel containing ethidium bromide ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Molecular Biology 2023Quote: ... and (v) the four PCR fragments listed above were digested with DpnI (New England Biolabs), gel-purified ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of purified DNA was treated with 10 units Exonuclease V (New England Biolabs) in a 50 μl reaction at 37°C for 30 min to remove ssDNA ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Developmental Biology 2019Quote: Pacy-2::acy-2 genomic was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Immunology 2021Quote: ... Samples were added to second-strand synthesis mix containing 2× NEB buffer 2 (NEB), 625 nM dNTP Mixture (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 50 ng PCR product was incubated with 2 µL 10X NEBuffer 2 (NEB, B7002S) and nuclease-free water adding up to 19 µL using the following program ...
-
bioRxiv - Biochemistry 2019Quote: 2 μg of nucleosomes were incubated with 2 Kunitz units of Micrococcal nuclease (NEB) in buffer containing 10 mM Tris HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 1M MgCl2 and 2 μl of 1 U/μl Xrn1 (M0338, NEB) were added after RNase H digest ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 30 min at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... α2-3,6,8,9 neuraminidase A (NEB), LB Broth (BD Difco™) ...
-
bioRxiv - Microbiology 2020Quote: ... 2) NEB Q5 (NEB M0491), 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... T4 RNA ligase 2 (NEB) and RiboLock RNase inhibitor (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL DpnI (NEB # R0176L) is then added and the reaction incubated 1h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 units DNase I (NEB) or both for 1 hour at 37°C and resolved on a denaturing urea polyacrylamide gel (15% ...
-
bioRxiv - Immunology 2020Quote: ... 2 U DNase I (NEB) was added to IVT mixture and further incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 1 h at 37°C and resolved on a denaturing urea polyacrylamide gel (20% ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL DpnI (NEB # R0176L) is then added and the reaction incubated 30 min at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 U UDG (NEB, M0280S), and 1X UDG buffer (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... in 1× NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... in 1x NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL ATP (NEB, B0202S), 2 μL 10X restriction digest buffer (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Set 2 (E7500S, NEB). Quality of the final library preparation was analysed on the Bioanalyzer using the High Sensitivity DNA reagents kit and cassettes (5067-4626 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and set 2 (NEB #7500S) according to the manufacturer’s protocol with minor modifications as noted below ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM ATP) (NEB) at 30 °C for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... with 2 mM MgCl2 (NEB), 0.2mM dNTPs (made in house) ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of BSA (NEB), 15 μl of dNTPs 10 mM ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...