Labshake search
Citations for New England Biolabs :
51 - 94 of 94 citations for MTH1 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Dissolved peptides were incubated with antiKcr antibody-coated agarose beads (Catalog No. PTM-503, PTM Biolabs, Hangzhou, China) overnight at 4 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Peptide constructs were assembled and integrated upstream of Venus using the NEBuilder HiFi Assembly kit (New England Biolabs). Correct assembly was verified by sequencing of inserts and flanking regions ...
-
bioRxiv - Biochemistry 2021Quote: ... primers containing overhangs of the 3x FLAG peptide were phosphorylated using the T4 polynucleotide kinase (New England BioLabs). Phosphorylated primers were used to PCR amplify pQLinkN-pgaD to generate the plasmid pQLinkN-pgaD-FLAG ...
-
bioRxiv - Microbiology 2021Quote: Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
bioRxiv - Microbiology 2020Quote: ... HI.fate vectors expressing the Zs-Green protein fused to EGFP through the 2A self-cleavage peptide were constructed by digesting HI.fate.E with BsiW I and Xho I restriction enzymes (NEB) and cloning two fragments ...
-
bioRxiv - Microbiology 2023Quote: ... Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
bioRxiv - Genomics 2023Quote: Each 900 ng of high molecular weight NA12878 DNA was preprocessed by first blocking at the 3’ ends with Klenow (exo-) (NEB) in the presence of 10 µM dideoxynucleotides and 1X NEBuffer 3.1 for 30m at 37°C ...
-
bioRxiv - Physiology 2021Quote: ... The biotinylated peptides were placed on streptavidin-coated plates and three rounds of solid-phase panning were conducted using 109 random 12-mer peptides fused to a minor coat protein of M13 (pIII) following the manufacture’s protocol (Ph.D-12 Phage Display Peptide Library Kit, NEB, E8110S). Sequenced data were subsequently analyzed as follows ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with 1 mM MnCl2 was used to remove the phosphorylation on the peptides and Staurosporin (NEB, Hitchin, UK) to occupy the active site pocket ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Immunology 2023Quote: ... 3000 ng of high molecular weight DNA was prepared by blocking available DNA ends with calf intestinal phosphatase (NEB Cat #M0525). DNA and dA-tails on all available DNA ends were cleaved by RNPs and Taq polymerase (New England Biosciences Cat #M0273 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Cell Biology 2024Quote: ... Thymidine was then removed by washing cells with culture media and blocking of existing CENP-A was performed by treatment with 10 mM SNAP-Cell® Block BTP (S9106S, NEB) for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... We first joined sequences for fluorescent protein mCerulean (CFP) and 2A peptide P2A (a ribosomal skip sequence) with Q5 (NEB) fusion PCR and added them to the pWPXL vector with Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Bioengineering 2020Quote: ... Respective peptide DNA coding sequences (CDS) were amplified from hACE2 via PCR and inserted using HiFi DNA Assembly Master Mix (NEB) for Gibson Assembly into the pcDNA3-SARS-CoV-2-S-RBD-Fc backbone linearized by digestion with NheI and BamHI ...
-
bioRxiv - Biochemistry 2022Quote: ... the sequence for the 50-residue hinge-region “C-peptide” (Ala317-Phe366) was removed via site directed mutagenesis (New England Biolabs). The construct further included the miniGs399 protein15 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3-FLAG-PKCα constructs expressing FLAG-tagged PKCα were generated by amplifying the coding region of PKCα from HeLa Tet-off cell total RNA and inserting it into pcDNA3-FLAG (45) immediately downstream of the FLAG peptide sequence using Gibson Assembly (NEB). Constitutive active PKCα-AE was generated by mutating alanine 25 into glutamic acid ...
-
bioRxiv - Developmental Biology 2022Quote: ... and zebrafish cachd1 ectodomain production constructs (ectodomain fused to hexahistidine and BirA ligase peptide substrate tags) were prepared by NotI/AscI restriction enzyme double digest (New England Biolabs) of pTT3-based vector backbones (50 ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lyophilized peptides were resuspended in 200 µl of 50 mM ammonium bicarbonate to which 3 µl of PNGaseF (New England Biolabs) were added for a 4h incubation at 37C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Plant Biology 2022Quote: ... a YFP sequence was inserted just after putative endoplasmic reticulum signal peptide sequences in LTPG1 and LTPG2 using the homologous recombination Gibson Assembly system (New England Biolabs), according to Kim et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... Coding sequences for mouse Gata4 and E2-Crimson preceded by an E2A self-cleaving peptide (E2A-E2-Crimson) were assembled using NEBuilder HiFi DNA assembly (NEB) to generate pCX-Gata4-E2A-E2-Crimson ...
-
bioRxiv - Cancer Biology 2023Quote: 20 μL of the lysate DNA containing the peptide library was PCR amplified with Q5 high-fidelity DNA polymerase (New England Biolabs), for 15 cycles in a 50 μL reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Immunology 2019Quote: ... activated and transduced T cells were incubated with GXR-B27 cells pulsed with the indicated peptide concentrations for 6 hours in presence of Brefeldin A (NEB; 420601). The cells were stained with anti-LNGFR-PE ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Molecular Biology 2023Quote: ... peptide sequences specific to an aMino sdAb were generated using the Ph.D.™-C7C Phage Display Peptide Library Kit (New England BioLabs, E8120S), a combinatorial library consisting of randomized display peptides with a disulphide constrained loop (AC-XXXXXXX-CGGGS ...
-
bioRxiv - Biochemistry 2020Quote: ... and peptides in one aliquot were deglycosylated by further treatment with 125 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA) for 16 h at 37 °C.
-
bioRxiv - Cell Biology 2021Quote: ... were made by cloning synthetic gene fragments encoding the CBS or TAT peptide sequences into NdeI and BamHI sites in pMAL-c5x (New England Biolabs, Ipswich, MA). The encoded cargo proteins thus have either a CBS or TAT sequence C-terminal to the MBP and a 6x His tag beyond.
-
bioRxiv - Microbiology 2020Quote: ... 25 μg of protein was precipitated from cell lysate as described in Methods and treated with peptide-N-glycosidase F (PNGase F; New England Biolabs, MT, USA) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: ... behind the α-factor signal peptide sequence using SmaI/EcoRI restriction enzymes and T4 DNA ligase (New England Biolabs, Beverly, MA, USA). Here ...
-
bioRxiv - Neuroscience 2021Quote: ... with 1% (w/v) octylglucoside containing 5 U endoglycosidase H (Endo H) or peptide: N-glycosidase F (PNGase F; both NEB, Frankfurt, Germany) at 37°C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... GST-IpaH4-3XFlag was cloned into pGEX6P-1 with a 3XFlag peptide followed by the coding sequence for ubiquitin using Gibson Cloning (NEB; Table S4). Sequence-verified constructs were transformed into E ...
-
bioRxiv - Biophysics 2019Quote: ... the imaging chamber was incubated in blocking buffer (10 mM Tris HCl pH 7.5, 50 mM NaCl, 1 mg/mL BSA [NEB], 1 mg/mL tRNA [Ambion]) for 1 h ...
-
bioRxiv - Genomics 2024Quote: ... Samples were then rinsed with 2X SSC before incubating with a blocking buffer (10% BSA, 3% v/v 6% v/v murine RNase inhibitor [NEB, M0314L] in 2X SSC) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were dried in a speed vac before peptides were deglycosylated with Endo H or PNGase F according to manufacturer’s instructions (P07025 & P0710S, New England Biolabs Inc., Hitchin, United Kingdom).
-
bioRxiv - Cell Biology 2022Quote: ... The DNA encoding the EGFP-fusion proteins and the P2A peptide was inserted by Gibson assembly using NEBuilder HiFi DNA assembly master mix (New England BioLabs, Ipswich, MA, USA). The HeLa Flp-In T-REx K44A Dynamin2-EGFP-P2A-Caveolin1-mCherry construct was obtained by in vitro mutagenesis of the pcDNA/FRT/TO/Dyn2-EGFP-P2A-Caveolin1-mCherry construct exchanging lysine at position 44 to an alanin using these primers ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA encoding EHD2-BFP and the P2A peptide was inserted by Gibson assembly using NEBuilder HiFi DNA assembly master mix (New England BioLabs, Ipswich, MA, USA). The Flp-In TRex HeLa cell lines were maintained in DMEM supplemented with 10% (v/v ...