Labshake search
Citations for New England Biolabs :
351 - 400 of 529 citations for M CSF Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The cDNAs were built by reverse transcription of proliferating MuSC mRNAs using M-MuLV Reverse Transcriptase (NEB #M0253L). mRNAs were extracted using NucleoSpin RNA Plus XS kit (Macherey-Nagel #740990.50) ...
-
bioRxiv - Neuroscience 2023Quote: ... and reversely transcribed into complementary DNA (cDNA) using M-MuLV reverse transcriptase (NEB.M0253S, New Englands BioLabs, Ipswich, MA). qPCR was performed using the Brilliant II SYBR Green QPCR master mix (Agilent Technologies ...
-
bioRxiv - Genetics 2023Quote: ... 1.2 M sorbitol) and resuspended in digestion buffer (Buffer B, 200 mM Vanadyl ribonucleoside complex [VRC from NEB] ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsRNA was synthesized from T7-linked DNA using the HI Scribe™ T7 High Yield RNA Synthesis Kit (New England, Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA was amplified with 12 cycles of PCR using the NebNext Hi-Fi 2X PCR Master Mix (New England Biolabs Inc, Ipswich, MA, Cat #M0541S). Following PCR ...
-
bioRxiv - Genomics 2019Quote: ... were ligated onto Hi-C ligation products bound to streptavidin beads for 2 hours at room temperature (T4 DNA ligase NEB, in ligation buffer, slowly rotating). After washing twice with wash buffer (5 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... The reaction was performed in temperature cycles of 37°C for 2 min and 16°C for 5 min using the restriction enzyme Bsa I-HF® V2 and the Hi-T4™ DNA ligase (from New England Biolabs; Bioconcept, Allschwil, Switzerland), followed by a final 10 min ligation at 16°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was done in bacterial strain Escherichia coli NEB® 10-beta (New England Biolabs, Frankfurt a. M., Germany) grown at 37 °C in lysogeny broth [47] supplemented with 60 mg L-1 ampicillin (Applichem ...
-
bioRxiv - Cancer Biology 2020Quote: ... The adaptor-ligated DNA was hybridized to custom Agilent biotinylated oligonucleotide probes across a 700bp region (53032 probes; 4.684 Mbp oligo) and then pulled-down by Dynabeads M-270 Streptavidin beads (NEB). The post-capture DNA library was amplified with STARR_in-fusion_F and STARR_in-fusion_R primers (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagmented samples were amplified by the addition of 2.5μL each of 10μM barcoded forward and reverse primers (Picelli et al., 2014) and 15μL Q5 2x HiFI MasterMix (New England Biolabs) using the following thermocycling conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... The urea concentration was then diluted to 5.5 M with 50 mM ABC and the samples digested with LysC (New England Biolabs) at 1:100 mass-ratio at 37°C for 3 hours with agitation ...
-
bioRxiv - Microbiology 2022Quote: ... RNAs were precipitated in cold ethanol and 0.3 M of sodium acetate and dephosphorylated using Calf-intestinal alkaline phosphatase (New England Biolabs), according to manufacturer protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 μg of supercoiled plasmid DNA was incubated at 37 °C for 3 hours with purified SpRY protein at a final concentration of 1 μM and IVT gRNA (prepared without DNase treatment) at a final concentration of 2 μM in Buffer 3.1 (NEB). Reactions were stopped by the addition of 1 μL of Proteinase K (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was synthesized from total RNA of 10-d-old seedlings using M-MuLV reverse transcriptase (New England Biolabs); each gene was amplified using specific primers (see Supplemental Table 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μg of each sgRNA and 60 pmol Cas9-NLS protein (EnGen® Spy Cas9 NLS, NEB, M0646 M) with the Lonza 4D X-unit ...
-
bioRxiv - Genomics 2022Quote: ... 10 min) and resuspended in 400uL Buffer M supplemented with 1 mM S-adenosyl-methionine (SAM, New England Biolabs) and 200uL aliquoted as a non-methylated control ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 μL of Round1 barcode mix (1x T4 DNA ligase buffer, 16 M/μL T4 DNA ligase (M0202L, NEB), 0.25 M/μL RNase Inhibitor ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was eluted from the gel overnight in 400 µl of 0.4 M NaCl with rotation at RT and precipitated with 96% ethanol in the presence of linear acrylamide (NEB).
-
bioRxiv - Cell Biology 2022Quote: ... Tracheal chitin was stained with 505 star conjugated chitin-binding probe (NEB, Frankfurt/M, Germany, used at 1:300). Nuclei were stained with 4’,6-Diamidino-2-Phenylindole ...
-
bioRxiv - Developmental Biology 2023Quote: ... A primer set annealing to the amplification sequences was used at a final concentration of 0.5 μM to amplify the pool of oligonucleotides using 12.5 μL 2 x NEBnext PCR master mix (New England BioLabs) and 3 μL of oligonucleotide pool (∼3 ng) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg RNA was used to generate library cDNAs using the enzyme M-MuLV Reverse Transcriptase (New England, Biolabs, USA) together with an RNase inhibitor (New England ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total cDNA for RT-qPCR was generated from 1.5 µg total RNA using a random primer mix and M-MuLV reverse transcriptase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Genomics 2019Quote: ... Human genomic DNA was fragmented by a dsDNA fragmentase (New England Biolabs) followed by end preparation and adapter ligation according to the NEBNext Ultra II DNA Library Prep Method for Illumina (New England Biolabs).
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Biochemistry 2022Quote: ... The coding region of human Cdc20N was cloned by USER® (NEB) into a modified pRSFDuet-1 vector (71341-3 ...
-
bioRxiv - Microbiology 2022Quote: ... or PCR amplified from human cDNA using Vent Polymerase (New England Biolabs), then introduced into the luciferase with an intron construct at the EcoRI site ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Genetics 2021Quote: ... 1 μg of RNA was reverse transcribed in cDNA using random hexamers and M-MuLV reverse transcriptase (New England Biolabs). Quantitative PCRs were assembled with Absolute QPCR ROX Mix (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... human emerin was first fused to the C-terminus of a SNAP tag by AscI and XhoI insertion in a pSNAP-tag(m) plasmid (NEB). SNAP-emerin was then subcloned into a modified pFUW lentiviral vector by NheI and AgeI insertion ...
-
bioRxiv - Molecular Biology 2021Quote: A CD22 cDNA fragment encoding the first two Ig-like domains fused to an EK-hIgG-Fc fragment was amplified by PCR and cloned into the mammalian expression vector pACP-tag(m)-2 (New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... Complementary DNA (cDNA) was synthesized from total RNA of all different time points with M-MuLV Reverse Transcriptase (NEB, M0253S) by following the manual of the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... end repair was carried out with a mixture of bead-immobilized T4 DNA polymerase and T4 polynucleotide kinase (both kind gifts of Dr. M. Xu, New England Biolabs) in a 20 µl volume of End Repair buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were labelled with 2.5 μM (0.5 μM for dSTORM imaging) SNAP-Surface Alexa Fluor 546 or 647 (indicated as SNAP546 and SNAP647 in this study) (NEB) for 20 min and optionally counterstained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Immunology 2021Quote: ... Two restriction sites NheI at the 5’ end and BamHI at the 3’ end were incorporated into the CD4-polypeptide linker plasmid which was then inserted into pACP-tag(m)-2 plasmid (New England Biolabs) to obtain pACP-CD4 ...
-
bioRxiv - Microbiology 2021Quote: ... VN173 fused to NiV-M was generated by exchanging Ub from the previously described VN173-Ub (Pentecost et al., 2015) for NiV-M using the Gibson Assembly Cloning Kit (New England BioLabs). MeV-M BiFC constructs were made by exchanging NiV-M fused to VN173 or VC155 for MeV-M using the Gibson Assembly Cloning Kit (New England BioLabs) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from 1 μg of total RNA using M-MuLV Reverse Transcriptase and Random Primers 6 (both New England Biolabs) at 42 °C for 60 min and diluted in 1:4 ratio by PCR grade water ...
-
bioRxiv - Microbiology 2020Quote: ... single-stranded cDNA was synthesized from 10 µg of RNA using 100 pM random hexamer primer (Integrated DNA Technologies) and M-MuLV Reverse Transcriptase (New England Biolabs). After reverse transcription ...
-
bioRxiv - Biochemistry 2022Quote: ... accordingly to manufacturer’s instructions and 1 μg of RNA was reverse-transcribed into cDNA using M-MuLV reverse transcriptase (New England Biolabs) and random hexamers ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA chimera was then cloned into the pACP-tag (m)-2 vector (addgene# 101126) using NheI and NotI (NEB) as the restriction sites ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Bioengineering 2019Quote: ... First-strand cDNA was synthesized using a random hexamer primer and M-MuLV reverse transcriptase (RNase H-; New England Biolabs). Second-strand cDNA synthesis was subsequently performed using DNA polymerase I and RNase H ...
-
bioRxiv - Molecular Biology 2019Quote: ... the RNA was mixed with 10 µM of custom 5’ adapter and the ligation reaction was done using T4 RNA ligase 1 (M0437M, NEW ENGLAND BIOLABS) and with RNasin Plus ...
-
bioRxiv - Biophysics 2019Quote: ... final products were separated from non-ligated fragments by electrophoresis using a 0.8-1.5% (m/V) agarose gel and extracted from the gel with the Monarch® DNA Gel Extraction Kit (NEB).
-
bioRxiv - Developmental Biology 2022Quote: ... using 200-300 ng of purified RNA as template and Moloney Murine Leukemia Virus (M-MuLV) Reverse Transcriptase (M0253, NEB). cDNA was synthesised using the standard first strand synthesis protocol with random hexamers (S1230 ...
-
bioRxiv - Cell Biology 2022Quote: ... treatment on the total RNA was performed and cDNAs were generated using the M-MuLV Reverse Transcriptase and random primers (NEB), as per the manufacturer’s protocol ...