Labshake search
Citations for New England Biolabs :
51 - 100 of 332 citations for M CSF Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription (RT) was performed with M-MuLV reverse transcriptase (NEB) according to manufacturer instructions with a short oligonucleotide to prevent annealing of the oligonucleotides on RNAs that lost a few nucleotides at the 3’ end during the migration (and would thus run faster in the reverse run ...
-
bioRxiv - Biochemistry 2023Quote: ... was coupled to magnetic beads (Dynabeads M-270 Epoxy, NEB 14302D) at the ratio of 10 μg antibody/mg of beads in the presence of 1 M ammonium acetate and 0.1 M sodium phosphate ...
-
bioRxiv - Bioengineering 2023Quote: PstI-HF restriction enzyme (NEB cat. no. R3140S/L/T/M)
-
bioRxiv - Bioengineering 2023Quote: BamHI-HF restriction enzyme (NEB cat. no. R3136S/L/T/M)
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using M-MuLV Reverse Transcriptase (NEB) enzyme ...
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.8 M guanidine HCl) was supplemented with Proteinase K (New England Biolabs), diluted to 8 units mL-1 ...
-
bioRxiv - Microbiology 2020Quote: ... and pAAVS1_c- LTatCL[M]) were linearized using 100 units of NsiI (NEB)/20 μg DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... AT5G02330 and AT2G13900 cDNA was synthesized using M-MuLV Reverse Transcriptase (NEB) with 100 ng of total RNA at 42ºC for 60 min ...
-
bioRxiv - Microbiology 2019Quote: ... First-strand cDNA synthesis was performed using M-MLV reverse transcriptase (NEB) wherein the 3’ adapter served as a primer ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µg of RNA digested with DNaseI (NEB, Frankfurt a. M., Germany) was used for reverse transcription of mRNA with the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mM dNTPs and 200 U M-MuLV (New England BioLabs, USA) which were treated following manufacturer’s instructions with some modifications ...
-
bioRxiv - Biophysics 2021Quote: ... Recombinant M-MuLV reverse transcriptase from the ProtoScript® II kit (NEB) was used to synthesize first strand cDNA from the annealed primer-MS2 RNA mix ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 M NaCl and 8 units/ml Proteinase K (New England Biolabs) in 1x PBS] ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA synthesis was achieved using the M-MuLV Reverse Transcription kit (NEB), according to manufacturer’s guidelines ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Microbiology 2019Quote: ... falciparum and human histones (New England Biolabs) (6µg) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 U RNase Inhibitor Human Placenta (NEB), 50 pmol Oligo d(T)23 (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Human CK2 was obtained from NEB (P6010S). IE2-NTD was phosphorylated in buffer provided by the manufacturer which contains 50mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was reverse-transcribed with M-MuLV reverse transcriptase (New England Biolabs, M0253) and random hexomers (ThermoFisher N8080127) ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA was reverse transcribed using M-MuLV reverse transcriptase (New England Biolabs) following the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2021Quote: ... yielding almost 1.6 M mapping-quality variants (homozygous in NEB, absent from WUS). ddRADseq libraries were de-multiplexed and barcodes removed and variants called using a GATK 4.0 best practices pipeline29 ...
-
bioRxiv - Genomics 2019Quote: ... 0.25 M sucrose for digestion with Micrococcal Nuclease (M0247, New England Biolabs NEB). After 15 min digestion at RT ...
-
bioRxiv - Genomics 2019Quote: ... 0.25 M sucrose for digestion with Micrococcal Nuclease (M0247, New England Biolabs NEB). After 15 min digestion at RT ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA was synthesized using the M-MLV RTase (New England Biolabs Japan) and subjected to the real-time qPCR using StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Cell Biology 2019Quote: ... First-strand cDNA synthesis was performed using M-MuLV Reverse Transcriptase (NEB M0253S) according to manufacturer’s recommendations with either oligo(dT ...
-
bioRxiv - Plant Biology 2022Quote: ... was used for cDNA preparation using M-MuLV Reverse Transcriptase (New England Biolabs). The cDNA sequence of TRB5 was amplified using gene specific Gateway-compatible primers according to the manufacturer’s instructions with primers specified in Supplemental Table 4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.75 µl 0.1 M DTT and 0.3 U/µl T4 Polynucleotide kinase (NEB), and then incubated at 37°C 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and reversely transcribed into complementary DNA (cDNA) using M-MuLV reverse transcriptase (NEB.M0253S ...
-
bioRxiv - Immunology 2024Quote: ... cDNA was synthesized from mRNA samples with M-MLV (New England Biolabs, M0253S) primed with random hexamers (Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Human HA-DHFR was subcloned from human cDNA to pcDNA4/TO by PCR using Q5 High Fidelity 2X mastermix (NEB). Human FPGS-FLAG and GGH-FLAG were subcloned from cDNA clones MHS6278-202755815 (Horizon Discovery ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... first-strand complementary DNA (cDNA) was synthesised using M-MuLV Reverse Transcriptase (NEB, USA). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA was synthesized using M-MuLV reverse transcriptase enzyme (New England Biolabs #M0253S) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: 1.5 μg of RNA was reverse transcribed using M-MuLV Reverse Transcriptase (NEB M0253L) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Plant Biology 2021Quote: ... First-strand cDNA was synthesized using oligo(dT) and M-MuLV reverse transcriptase (NEB). Real-time qPCR was performed using PowerUp™ SYBR™ master mix (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... then 1µl M-MLV reverse transcriptase enzyme was (New England BioLabs, Catalogue no.-M0368) added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized with M-MuLV Reverse Transcriptase (200 U/μL, New England Biolabs). Real-time PCR was performed by a CFX-96 real-time system (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... and converted to cDNA using random primers and M-MuLV RT-PCR enzyme (NEB). Proinsulin-specific primers (GTGAACCAGCACCTGTGC Fw and CGGGTCTTGGGTGTGTAGAAG Rv ...
-
bioRxiv - Cancer Biology 2024Quote: ... Equal amounts of RNA were transcribed with reverse-transcription (M-MuLV Reverse Transcriptase, NEB). Quantitative real-time PCR (qRT-PCR ...