Labshake search
Citations for New England Biolabs :
151 - 200 of 2929 citations for L Valine 13C5 95 97%; 15N 96 99%; 2 3 D2 97%+ since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 95°C for 10 minutes and equal amounts of lysates (180 ug) were treated with either 1uL of EndoH (NEB), PNGase F (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 95°C/15 s and annealing/extension: 65°C/5 min) of PCR using Q5 high-fidelity DNA polymerase (NEB). Amplicons were purified using 1× AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Bioengineering 2022Quote: ... pGRNA-galK was linearized by PCR using primers 95 and 391 and assembled with the sacB-fragment by Gibson assembly (New England Biolabs).
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was fragmented at 95°C for 5 min by using a Next Magnesium RNA Fragmentation Module (New England Biolabs), and cleaned up by using a MinElute PCR Purification Kit (Qiagen) ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted from individual embryos by heat shock denaturation in 50 mM NaOH (95°C for 20 minutes) and used for PCR by using Q5 High-Fidelity Taq Polymerase (New England Biolabs). The presence of specific amplicons was tested by running the PCR product on 1% agarose gel ...
-
bioRxiv - Cell Biology 2023Quote: ... A de novo sequence was formed by annealing oligo 3 and 4 over a 30 min temperature gradient from 95°C to 25°C and integrated via T4 ligase (New England Biolabs). pZE13d-C_PfCen3 and _PfCen4 were generated by digesting pZE13d-C with BamHI-HF and SalI-HF and integrating codon optimized PfCen3 and PfCen4 encoding sequences PCR amplified via primer pairs P34+35 and P36+37 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Table S4) were hybridised by slow cooling down from 95-25°C and then phosphorylated using the T4 Polynucleotide Kinase (NEB). The digested plasmid and the hybridised oligonucleotides were ligated using the T4 ligase (NEB ...
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Cell Biology 2024Quote: ... containing a 5′-Biotin-PC group and a 3’-OH (Sup. Table. 2) were ligated to the 5′ end of RNAs using T4 RNA ligase (NEB, Cat #M0204S) for 3 hours at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 µL of the PCR product was incubated with 2 U of EcoRI-HF® in 1X CutSmart® Buffer (New England BioLabs, Ipswich, MA, USA) at 37°C for 60 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cell Biology 2021Quote: ... 20µg of protein lysates and media samples were incubated with glycoprotein denaturation buffer at 95°C for 10 min and treated with 0.3µl Endo H (NEB; Catalog no #P0702) enzyme in glyco-buffer 3 for one hour at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μ L of Protoscript II Reverse Transcriptase (200U/μ L, Catalog No. M0368, New England BioLabs Inc.), 2 μ L of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Genomics 2019Quote: ... 96 μM S-adenosylmethionine (SAM; New England Biolabs, NEB), and 200 U M ...
-
bioRxiv - Genomics 2019Quote: ... 96 μM S-adenosylmethionine (SAM; New England Biolabs, NEB), and 200 U M ...
-
bioRxiv - Physiology 2023Quote: ... and 96 Unique Dual Indices (E7765L, New England Biolabs). The skin RIN scores were much lower ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA ligase (NEB, Cat. #M0205 L), 5 μl of E ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA Polymerase (NEB, Cat. #M0209 L), 1 μl of 10mM dNTP (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... and T7 DNA Ligase (NEB M0318S/L) with the same cycling conditions as the part vectors.
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... or Amylose Resin (NEB, 1 L, USA), that had been prewashed with respective lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.5□l of 10m/ml BSA (NEB), 15□l of 2.1 buffer (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 12 cycles of 95°C for 15 seconds and 60°C for 4 min followed by exonuclease I (New England Biolabs, PN M0293S) treatment at 37°C for 30 minutes and 80°C for 15 minutes to remove any unincorporated primers ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The bead slurry was directly treated with 3 µL Klenow (3’→5’ exo-) (NEB) in 50 µL NEB Buffer #2 with 0.2 mM ATP at 37 °C for 30 min to add 3’ overhangs to DNA ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 µl USER Enzyme (NEB) was used with size-selected ...
-
bioRxiv - Biophysics 2020Quote: ... and 3-biotin-GTP (NEB) and purified using MEGAclear ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 units of DNaseI (NEB) were added and the mixture was incubated at 37°C for 1 h.
-
bioRxiv - Microbiology 2020Quote: ... 3) NEB LongAmp (NEB M0287) and 4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3□μf USER Enzyme (NEB) was then used with the size-selected ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL exonuclease buffer (NEB) and 4 μL nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL XmaI (NEB R0180S) was added to fragment chromatin ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl HinP1I (NEB R0124S), 3 μl DdeI (NEB R0175L) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl CviAII (NEB R0640L), 3 μl FspBI (ThermoFisher ER1762) ...
-
bioRxiv - Genomics 2022Quote: ... 3 μl DdeI (NEB R0175L), 3 μl CviAII (NEB R0640L) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 µL Rnl2KQ (NEB M0373S), water to 30 µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μl USER Enzyme (NEB) was then incubated with size-selected ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index Primers Set 3 (NEB). Amplified libraries were cleaned up using Sample Purification Beads (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of Universal nuclease (Pierce; 125U/L of culture) and 10 μl of DNaseI (NEB; 20U/L of culture) were added and the mixture allowed to incubate for 10 min at RT ...