Labshake search
Citations for New England Biolabs :
1 - 50 of 227 citations for L Leucine 13C6 99%;15N 99% Microbiolog Pyrogen Test since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... the 1:99 target:background sample was digested with FspEI (New England Biolabs) according to the manufacturers protocol (incubation at 37°C for 90 minute ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex, Deduped and Fivepercent methods and 10 for Illumina and 13 for NEB). We normalized the data using the DESeq2(40 ...
-
bioRxiv - Molecular Biology 2023Quote: ... fixed nuclei resuspended in 171 uL SPBSTM were mixed with 99 uL NTP buffer and 30 uL T7 polymerase mix (New England Biolabs) and incubated in a 1.5 mL LoBind tube (Eppendorf ...
-
bioRxiv - Molecular Biology 2021Quote: ... were subjected to a PCR test (NEB Taq Polymerase ...
-
bioRxiv - Molecular Biology 2024Quote: ... Initial test concentrations were adapted from NEB kit manufacturer recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... where the Emp24 transmembrane domain (residues 173-193) was replaced by 26 leucines using Gibson assembly (New England Biolabs). To construct pSP-FLAG-Cp ...
-
bioRxiv - Microbiology 2021Quote: ... we performed test-digestion of the generated plasmids with restriction enzymes (New England Biolabs), and analyzed the fragment pattern via gel electrophoresis ...
-
bioRxiv - Synthetic Biology 2020Quote: The RecBCD degradation test was performed following the instructions provided by New England Biolabs (NEB) with a minor modification detailed as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Desired PCR cycle numbers were determined in test endpoint PCRs using Q5 DNA polymerase (NEB M0491L). Final HiC libraries were generated from 4-6 individual PCR reactions ...
-
bioRxiv - Genomics 2022Quote: ... we chose four enzymes to test in the Tapestri Barcoding Mix buffer: AciI (NEB, recognition site CCGC), HpaII (NEB ...
-
bioRxiv - Bioengineering 2020Quote: ... Esp31 (NEB R0734S/L), and T7 DNA Ligase (NEB M0318S/L ...
-
bioRxiv - Bioengineering 2020Quote: ... Esp31 (NEB R0734S/L), and T7 DNA Ligase (M0318S/L) ...
-
bioRxiv - Bioengineering 2020Quote: ... Esp31 (NEB R0734S/L), and T7 DNA Ligase (M0318S/L ...
-
bioRxiv - Microbiology 2024Quote: ... Murine (NEB, #M0314S/L) and nuclease-free water at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: The cleaved amplified polymorphic sequence (CAPS) test utilising the restriction enzyme Taq I (New England Biolabs® Inc., U.S.A) to identify the I365N/R/S mutant in Bos1 was carried out as described by Oshima et al.35 In this study ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.1 g/L BSA (NEB), 1x EvaGreen Dye (Biotium ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.1 g/L BSA (NEB) and 1x EvaGreen Dye (Biotium) ...
-
bioRxiv - Molecular Biology 2019Quote: ... ChIP-qPCR was performed to test the efficiency of the ChIP and libraries were prepared with NEBNext Ultra DNA Library Prep Kit Illumina (NEB) according to the protocol and sequenced on a HiSeq2500 (Illumina ...
-
bioRxiv - Microbiology 2020Quote: RNA samples were confirmed to be DNA-free by conducting test PCRs on the 16S rRNA gene and converted to cDNA using the LunaScript RT SuperMix Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ligation Test 1 was processed directly to index PCR while product in Ligation Test 2 was digested by 12.5 units of RNase H (NEB, Cat.No.M0297) at 37°C for 20min before index PCR.
-
bioRxiv - Immunology 2021Quote: ... and used as template to test for binding of the PMCA4b promoter region using Q5 hot start polymerase (NEB biolabs) and the primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... coli DNA ligase (NEB, #M0205 L), 5 μl of E ...
-
bioRxiv - Developmental Biology 2020Quote: ... coli DNA Polymerase (NEB, #M0209 L), 1 μl of dNTP (0 .2 mM) ...
-
bioRxiv - Bioengineering 2020Quote: ... BsaI-HF v2.0 (NEB R3733S/L), and T7 DNA Ligase with the same cycling conditions as the part vectors.
-
bioRxiv - Neuroscience 2023Quote: ... The sequencing libraries were generated by Genomescan using the NEBNext Low Input RNA Library Prep Kit from Illumina (New England Biolabs, cat#E6420S/L). In short ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15□l of 2.1 buffer (NEB), 30 units of SSP1 (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... Exonuclease I treatment (NEB M0293 L) was used to remove excess primers ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μ L of Protoscript II Reverse Transcriptase (200U/μ L, Catalog No. M0368, New England BioLabs Inc.), 2 μ L of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA ligase (NEB, Cat. #M0205 L), 5 μl of E ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA Polymerase (NEB, Cat. #M0209 L), 1 μl of 10mM dNTP (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... and T7 DNA Ligase (NEB M0318S/L) with the same cycling conditions as the part vectors.
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... or Amylose Resin (NEB, 1 L, USA), that had been prewashed with respective lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1.5□l of 10m/ml BSA (NEB), 15□l of 2.1 buffer (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... RNAs for the in vitro test were transcribed using a HiScribe™ T7 high yield RNA synthesis kit (New England BioLabs, Ipswich, MA) and then column purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of Universal nuclease (Pierce; 125U/L of culture) and 10 μl of DNaseI (NEB; 20U/L of culture) were added and the mixture allowed to incubate for 10 min at RT ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 l of the DNA was used in a 50 l PCR reaction with the enzyme Q5 polymerase (New England Biolabs) and the primers Cytb-f AGTCCTAGTGTAATGGAAGCand Cytb-r ATCTTCAACGTGTTTAGCACC (annealing temperature 61.5°C) ...
-
bioRxiv - Microbiology 2021Quote: ... L: 100 bp DNA Ladder (New England Biolabs). 1 ...
-
bioRxiv - Bioengineering 2023Quote: T4 Polynucleotide Kinase (NEB cat. no. M0201S/L)
-
bioRxiv - Bioengineering 2023Quote: Bsu36I restriction enzyme (NEB cat. no. R0524S/L)
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biophysics 2019Quote: ... and L+512 were each digested with HindIII (NEB) for one h at 37 °C in the CutSmart™ buffer (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: BsaI-HFv2 restriction enzyme (NEB cat. no. R3733S/L)
-
bioRxiv - Genetics 2020Quote: ... 5 μl of Klenow exo- (NEB M0212S/L, 5U/μl) was added ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1.5 µ l of T4 Polynucleotide Kinase (NEB, M0201L). Following incubation ...
-
bioRxiv - Plant Biology 2022Quote: ... enzyme (MBP-DcATX1C) and S-adenosyl-L-methionine (SAM; NEB) were incubated for 0h ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-L-lactyllysine (pan-Kla, PTM BIOLABS, PTM1401, 1:1000), anti-H3K9la (PTM BIOLABS ...
-
bioRxiv - Bioengineering 2023Quote: SalI restriction enzyme (NEB cat. no. R0138S/T/L/M)
-
bioRxiv - Bioengineering 2023Quote: KpnI-HF restriction enzyme (NEB cat. no. R3142S/L/M)