Labshake search
Citations for New England Biolabs :
351 - 400 of 2107 citations for L Alanine N T Boc 2 13C 98 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... PolyA + fraction was isolated from 4.5 μg of DNAse-treated total RNA using NEBNext Oligo d(T)25 Magnetic beads kit (NEB, USA), according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 μg of total RNAs from 12-day-old Arabidopsis leaves were extracted using the Trizol method and incubated with 30 μl of pre-equilibrated oligo d(T)25 magnetic beads (NEB) for 15 minutes at room temperature with continuous rotation ...
-
bioRxiv - Molecular Biology 2022Quote: ... and mRNA fragments with a poly(A) tail were isolated by Oligo d(T)25 Magnetic Beads (NEB Biolab, S1419S). Illumina sequence adaptors were added during reverse transcription with SMRT methods (Wang et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The first and last 500 bp of the gene and the antibiotic cassette were then introduced in the pGEM-T Easy vector using HiFi DNA assembly (New England Biolabs) resulting in plasmids pLytA and pSpxB (Figure 9 ...
-
bioRxiv - Microbiology 2023Quote: ... and eukaryotic mRNA was removed by binding and discarding the eukaryotic mRNA polyA region to oligo d(T)25 magnetic beads (England Biolabs). Finally ...
-
bioRxiv - Immunology 2023Quote: ... mRNAs were enriched by incubation with Oligo d(T) Magnetic Beads (New England Biolabs, Cat. No. S1419S, Ipswich, MA, USA) and then fragmented/eluted by incubation at 94°C for 9 min ...
-
bioRxiv - Cancer Biology 2023Quote: Genetic perturbations from CRISPR-RNP were quantified from genomic DNA (gDNA) that was extracted from T cells using QuickExtract Buffer (NEB) according to manufacturer’s recommendation ...
-
bioRxiv - Molecular Biology 2022Quote: Polyadenylated RNA was purified from the DNase-treated total RNA using the oligo d(T)25 magnetic beads (NEB, S1419) and used for the library preparation ...
-
bioRxiv - Plant Biology 2023Quote: ... We used 1 μg total RNA for mRNA purification using the NEBNext Oligo d (T) 25 magnetic isolation module (New England Biolabs), followed by first strand cDNA synthesis using NEBNext Ultra II RNA Library Prep Kit for Illumina according to the manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... coli constitutive ribosomal promoter J23119 with a poly-T region directly downstream of the sgRNA sequence for transcription termination using KLD mutagenesis (New England Biolabs). pBR322 and pET28 expression plasmids were co-transformed into E ...
-
bioRxiv - Microbiology 2024Quote: ... Polyadenylated RNA was then isolated from the whole-cell RNA using NEB Oligo d(T)25 Magnetic beads (NEB, S1419S) according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... addition of a N-terminal Hemagglutinin (HA) epitope was done using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) following manufacturer recommendations.
-
bioRxiv - Genomics 2020Quote: ... libraries were quantified by qPCR using either the NEBNext® Library Quant kit (New England Biolabs, Cat. N: E7630S) or the KAPA Library Quantification Kit (scRNA-seq libraries only ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified on the streptavidin beads using the EpiMark Hot Start Taq (New England Biolabs, Cat. N: M0490) using following program ...
-
bioRxiv - Biochemistry 2020Quote: ... Glycans were incubated with different exoglycosidases in different sequences: (i) Streptococcus pneumonia β-N-acetylglucosaminidase (GUH, New England Biolabs); (ii ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Biophysics 2021Quote: ... 3 mM CaCl2 and 0.02% DDM) was incubated with 2000 units of N-glycosidase F (PNGase F) (New England BioLabs) at room temperature for 1 h ...
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The Cas9/gRNA expression construct pTREX-n-Cas9 was first modified using the Q5 mutagenesis kit (NEB, Ipswich, Massachusetts), primers 5’-CCCAAAAAGAAAAGGAAGGTTGATTAGAAGCTTATCGATACCGTCGAC-3’ and 5’-GTCCTCGACTTTTCGCTTCTTTTTCGGGTCGCCTCCCAGCTGAGA-3’ ...
-
bioRxiv - Microbiology 2019Quote: ... Pellets were resuspended in PBS and in some cases treated with N-glycosidase F (PNGase F; New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Neuroscience 2022Quote: Proteins from neuronal culture at DIV 14 were extracted as described above and treated with and without N-glycanase or endoglycosidase H according to manufacturer’s instructions (New England Biolabs). The lysates were analyzed with Western blot using LAMP1 (1:4000 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR analysis of total DNA extracted from oysters (N=60) used the high fidelity Q5 polymerase (New England Biolabs) in a total volume of 50 μL under the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning of the expression vector was performed using NEBuilder HiFi DNA Assembly Master Mix (Gibson cloning) and was performed according to manufacturer’s guidelines (cat. n° E2621L, New England Biolabs). In addition ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... Enzymatic deglycosylation of NTD was carried out by adding 2.5 L Endo Hf (NEB) per 20 μg of NTD and incubating for 24 hrs at 25 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Deletion mutants of hnRNP L and SETD2 were constructed by PCR (Phusion polymerase, NEB) using full-length hnRNP L and SETD2 ...
-
bioRxiv - Microbiology 2022Quote: ... purified using the Monarch RNA Cleanup Kit (T2050S/L, New England Biolabs, Ipswich, Massachusetts), reannealed by heating to 94°C and slowly cooling to room temperature over 50 min ...
-
bioRxiv - Genomics 2022Quote: ... The NEBNext® Ultra DNA Library Prep kit for Illumina (cat# NEB #E7370S/L) was used to process the DNA samples ...
-
bioRxiv - Cell Biology 2023Quote: ... RNAs were selected using the NEB Next Poly A+ Isolation Kit (NEB #E7490S/L). Poly A+ fractions were eluted ...
-
bioRxiv - Genetics 2021Quote: ... 2 × 2 µg of gDNA were digested in parallel with 50 units of DpnII (NEB #R0543L) and NlaIII (NEB #R0125L ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µl T4 DNA ligase buffer and 2 µl 10 mg/ml BSA (New England Biolabs). These reactions were placed in a thermocycler with following program ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL NEBNext Bacterial rRNA depletion solution and 2 µL Probe Hybridization Buffer (NEB, CN E7850) were mixed with cells on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNase-free BSA (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM Vanadate (Sodium Orthovanadate, NEB, pre-incubated for ten minutes at 95 °C to dissociate Vanadate oligomers ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μL 10 mM dNTPs (NEB), 9 μL Nuclease-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... 2× Protoscript Buffer (New England Biolabs), 12 mM MgCl2 (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Phusion buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM Ribonucleoside Vanadyl Complex (NEB), Roche cOmplete™ ...
-
bioRxiv - Genomics 2020Quote: ... + 2 uL DpnI (New England Biolabs) + up to 100 uL water.
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl BSA (New England Biolabs), 10 μl dNTPs (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl SrfI (New England Biolabs), and MilliQ (until a volume of 50 μl) ...