Labshake search
Citations for New England Biolabs :
301 - 350 of 1809 citations for Interleukin 10 Receptor Alpha IL10RA Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... Escherichia coli 10-beta (New England Biolabs) was used for plasmid construction ...
-
bioRxiv - Bioengineering 2023Quote: ... NEB 10-beta (NEB cat. no. C3019), or NEB Stable (NEB cat ...
-
bioRxiv - Microbiology 2023Quote: ... 10% NEBuffer 3 (New England Biolabs, #B7003S) in a thermocycler at 85°C for 3 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 U/mL of DNaseI (NEB, M0303S), 1x cOmplete™ protease inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2023Quote: ... 10 units of restriction enzyme XhoI (NEB) were added to the nucleosome array with and without PU.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RP1 primer (NEB), 1 µL ddH2O and PCR amplified for 16-18 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RPI primer (NEB), 2 µL 10 µM RP1 primer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10×T4 ligase buffer (NEB), 0.2 μl 0.1 M ATP (Thermo Fisher) ...
-
bioRxiv - Genomics 2023Quote: ... restriction enzyme (10 units of HpyCH4IV [NEB] for PCR7 and PCR31 ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
bioRxiv - Neuroscience 2023Quote: ... in 1:10 CutSmart Buffer (BioLabs #B6004S) at 37°C for 1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 U of T7 endonuclease I (NEB) was added and incubated for 15 min at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Scaffold strands (10 nM, M13mp18, Bayou Biolabs) were mixed with staple strands (100 nM ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 units of RNaseH (New England Biolabs) were added to the mix and allowed to digest at 37°C for 1 h ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µL HiFi 2X Master Mix (NEB), and water up to 20 µL ...
-
bioRxiv - Synthetic Biology 2023Quote: Restriction endonuclease BsaI (10 U/μL) (NEB), supplied with 10x NEB Buffer.
-
bioRxiv - Genomics 2023Quote: ... 10 μl Large Klenow Fragment (NEB #M0210L) was added and the chromatin is incubated for 15 min at 37°C with shaking ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB, S1402S)) and incubated overnight at 37°C in a humidified chamber ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Biophysics 2024Quote: ... 10 units of calf intestinal phosphatase (NEB), 5 units of antarctic phosphatase (NEB) ...
-
bioRxiv - Plant Biology 2021Quote: ... and anti-MBP antibodies (NEB), respectively.
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibodies (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB).
-
bioRxiv - Biophysics 2021Quote: ... in 500 μl T4 ligase buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP and 10 mM DTT, pH 7.5, NEB). Before adding the ligase ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 nM tritiated pSP1 was nicked either using 50 nM Cas12a RNP (WT protein with crRNA 24) at 25°C in Buffer RB for 10 s or using 10 units Nt.BspQI (New England Biolabs) per µg DNA ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10 µL RT mix (5 µL 5x Maxima RT Buffer, 1.25 µL 10 mM/each dNTP [New England Biolabs #N0447S] ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibody (New England BioLabs). An InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bound antibodies were detected by incubation with DyLight 800-conjugated secondary antibodies (New England BioLabs), and analysed using an InnoScan 710-IR scanner (Innopsys) ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were then incubated overnight at 37 °C in Hybridization Buffer (10% Formamide, 10% 20x SSC, 400 µg/ml E. coli tRNA (New England Biolabs), 5% dextran sulfate ...
-
bioRxiv - Biochemistry 2019Quote: ... and ddH2O to bring the volume 10 µL were mixed with 10 µL 2X NEBuilder HiFi DNA Assembly Master mix (New England Biolabs) and incubated at 50 °C for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... and ddH2O to bring the volume to 10 μL were mixed with 10 μL 2X NEBuilder HiFi DNA Assembly Master mix (New England Biolabs) and incubated at 50 °C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL of 10 μM FISH probes in hybridization buffer (10% dextran sulfate [Sigma], 2mM vanadyl ribonucleoside complexes [#514025, NEB] ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCC libraries were generated by digesting the chromatin in low Ca2+ MNase buffer (10 mM Tris-HCl pH7.5, 10 mM CaCl2) for 1 h at 37°C with MNase (NEB, M0247) added in varied concentrations (17-19 Kunitz U) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 15 μl of 10 mg/ml BSA and 10 μl of 400 U/μl of T4 DNA ligase (NEB, M0202)) and incubated 4h at 16ºC with mixing (800 rpm ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we added 10 ng of template plasmid to 100 μl of a PCR reaction mix that contains 10 μl of 10×ThermoPol buffer (M0267L, NEB), 2.5 μl of Taq DNA polymerase (M0267L ...
-
bioRxiv - Genomics 2020Quote: ... The treated RNA samples were incubated with 100 μM RNA rP5_RND oligo (final 10 μM, Table S3) 2h at 25°C with 10 Units of T4 RNA ligase 1 (NEB). Please note that we used an RNA oligo ...
-
bioRxiv - Cell Biology 2020Quote: ... or using 400 U of T4 DNA ligase and 1X reaction buffer (50 mM Tris-HCl, 10 mM MgCl2 1 mM ATP, 10 mM DTT, New England Biolabs) at 16°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... 200 ng ΔVC1807::ErmR transforming DNA was added and reactions were incubated at 30 °C for 10 minutes before the addition of 10 units of DNAse I (NEB) to prevent additional DNA uptake ...
-
bioRxiv - Immunology 2020Quote: ... and PI3-A12 Fab were produced by incubating each 10 mg of IgG with 10 μg of LysC (New England Biolabs) overnight at 37°C followed by incubating with protein A for 1 hour at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Bioengineering 2021Quote: ... was carried out (25 ng linearized vector, 10 ng purified insert, 10 µL 2 x Gibson Assembly Master Mix (New England BioLabs) and up to 20 µL H2O were mixed and incubated at 50°C for 1 hour) ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Table S3 ...
-
bioRxiv - Microbiology 2023Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Supplementary Table 4 ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were pelleted by centrifuging at 500 g for 5 min at 4 °C and resuspended in 200 μl 1X NEBuffer 2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg/ml BSA; NEB, B7202) in a 1.5 ml tube ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...