Labshake search
Citations for New England Biolabs :
1 - 50 of 2052 citations for IL 5 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Immunology 2022Quote: ... was amplified from the synthetic S gene and cloned into the EcoRI and HindIII digested pXC17.4 CHO expression vector with a secretion signal sequence using NEBuilder HiFi DNA assembly kit (New England Biolabs, E5520). Similarly ...
-
bioRxiv - Developmental Biology 2019Quote: ... of unc-3 and lin-39 were amplified and then ligated to cholinergic (cho-1, unc-3) or GABAergic (unc-47) promoters using Gibson Assembly Cloning Kit (NEB #5510S). For unc-3 RNAi ...
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Cancer Biology 2021Quote: ... and succinyl-lysine (PTM Biolabs, Chicago, IL, USA) were used to capture SIRT1-SIRT7 proteins overnight at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... and m7G(5′)ppp(5′)A (NEB, #S1405S) also referred throughout the manuscript as N7-meGpppG and N7-meGpppA for consistency ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL RNase H (5 U/µL, NEB), 2.5 µL RNase III (1 U/µL ...
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 µl Taq 5× Master Mix (New England Biolabs) and 18 µl Milli-Q water (18.2 MΩ cm) ...
-
bioRxiv - Developmental Biology 2023Quote: ... then capped with m7G(5’)ppp(5’)G (NEB) and tailed with a poly(A ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Microbiology 2019Quote: ... falciparum and human histones (New England Biolabs) (6µg) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 U RNase Inhibitor Human Placenta (NEB), 50 pmol Oligo d(T)23 (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Human CK2 was obtained from NEB (P6010S). IE2-NTD was phosphorylated in buffer provided by the manufacturer which contains 50mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl T4 PNK (NEB M0201, 5 U/μl), and incubated for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)G RNA (GpppG) (NEB, # S1407S) are from New England Biolabs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’-cap was removed using RNA 5′ pyrophosphohydrolase (Rpph, NEB) followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Developmental Biology 2021Quote: ... pFastBac dual vector containing the sequence for the N-terminally 6xHis-tagged human Naa15 and truncated human Naa10 (residues 1-160) sequences was digested using KpnI-HF (NEB) and XmaI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Human HA-DHFR was subcloned from human cDNA to pcDNA4/TO by PCR using Q5 High Fidelity 2X mastermix (NEB). Human FPGS-FLAG and GGH-FLAG were subcloned from cDNA clones MHS6278-202755815 (Horizon Discovery ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2023Quote: ... MARCH2 chimeras containing the TM domains from either human MARCH4 or human transferrin receptor (TR) were generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) and the primers listed in Supplemental Table S2 ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Biophysics 2020Quote: ... from human origin were all purchased from NEB. The H2A/H2B and H3.1/H4 were mixed in 2(H2A/H2B)2:1(H3/H4)4 molar ratio to form octamers.
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human histone H4 (New England Biolabs # M2504S) was used as a substrate ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...