Labshake search
Citations for New England Biolabs :
551 - 600 of 824 citations for IL 4 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Biophysics 2021Quote: We produced the vector PB PGKp-PuroR L30p MCS-GDGAGLIN-HaloTag-3xFLAG by amplifying the human L30 promoter with prAH675 and prAH676 and assembling into AsiSI- (NEB R0630) and XbaI- (NEB R0145 ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA substrates for in vitro cleavage represent fragments of human mitochondrial DNA amplified by PCR in Q5® High-Fidelity 2X Master Mix (M0492L, NEB). As a template ...
-
bioRxiv - Immunology 2021Quote: Point or deletion mutations were prepared from human or mouse CRT expression clones in pCMV3-C-Myc (SinoBiological) using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s protocol and primers designed using the NEBaseChanger™ web tool ...
-
bioRxiv - Systems Biology 2020Quote: ... rRNA depletion and library preparation for sequencing was completed with the NEBNext protocol (‘Protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Developmental Biology 2020Quote: A digoxin-labeled human H19X probe was transcribed in situ from a linear template plasmid by T7 RNA polymerase (NEB, UK) with Digoxin-labeled Uridine (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... per 1g of wet cell weight and 1 Unit of 30 Units/μL RNase Inhibitor (from human placenta; New England Biolabs (NEB), No ...
-
bioRxiv - Cell Biology 2021Quote: ... ORF was amplified from MCF10A human mammary cells using specific primers (listed in Table S2) with Q5 High-Fidelity 2X Master Mix (New England BioLabs, # M0492), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared according to the protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) ...
-
bioRxiv - Neuroscience 2022Quote: All anti-tau monoclonal antibodies were generated by the hybridoma approach against recombinant tau aggregates (human full-length tau) encapsulated in the ACM Polymersomes (ACM Biolabs, Singapore) and purified by size exclusion chromatography (SEC ...
-
bioRxiv - Developmental Biology 2023Quote: Human and bovine XIST E repeats were PCR amplified from cDNA generated from either total RNA of Ishikawa (human) or bovine stromal cells (Supplementary Table S4) with the Q5 High-Fidelity DNA polymerase (NEB, UK) or the non-proofreading Taq DNA Polymerase (EP040 ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA from 1000 ng total extracted RNA was depleted using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat; New England Biolabs Inc.). The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... W165F and S169A) were introduced into human PSEN1 cDNA cloned into the pMSCVpuro vector using Q5 Site-Directed Mutagenesis Kit (NEB BioLabs) according to the standard protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using a pre-poured amylose column containing 4 mL amylose resin (New England Biolabs, E8021L) followed by size exclusion chromatography (protein buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA was first chemically fragmented (4 min) and then enzymatically treated with Antarctic Phosphatase (NEB#M0289S) and T4 Polynucleotide Kinase (NEB#M0201S) ...
-
bioRxiv - Immunology 2021Quote: ... 240 nM dT-primer* (Metabion, Planegg, Germany) and 4 U RNase Inhibitor (New England Biolabs, Frankfurt, Germany). Reverse transcription and addition of the template switch oligo was performed at 42 °C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Biochemistry 2020Quote: ... The second aliquot was incubated overnight at 37 °C with β1-4 galactosidase (New England Biolabs #P0745) using the same reaction conditions as the neuraminidase above ...
-
bioRxiv - Neuroscience 2022Quote: ... Gelated samples were digested in 4 U/ml proteinase K buffer (New England Biolabs, Ipswitch, MA, USA) with 50 mM Tris pH 8.0 (Serva ...
-
bioRxiv - Cell Biology 2022Quote: ... Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: Each reaction contained 4 µL of 2X Luna Universal qPCR Master Mix (New England Biolabs, cat#M3003E), 0.4 µL of each 20X primer assay ...
-
bioRxiv - Cell Biology 2022Quote: ... was digested for 4 h at 37 °C using the restriction enzyme BbsI (#R3539S, New England Biolabs) and run on a 1 % agarose gel for 3.5 h at 100 V ...
-
bioRxiv - Developmental Biology 2021Quote: ... gently resuspended in fixation buffer (PBS, 0.1% saponin, 4% PFA, RNAsin [New England Biolabs #M0314] 1:20) and incubated for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µM gRNA pool (3 gRNAs in total) in 4× Cas9 Reaction Buffer (New England Biolabs) at 25°C for 10 min in a 5 µl reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... 4 μg of total RNA were reverse-transcribed by the M-MLV reverse transcriptase (New England BioLabs) following the manufacturer specifications and using oligo d(T ...
-
bioRxiv - Molecular Biology 2021Quote: ... Table 4 was end labeled using gamma-ATP and T4 Polynucleotide Kinase radioactive labeling protocol from NEB. Labelled oligos were purified using GE Healthcare illustra ProbeQuant G-50 Micro Columns and the membrane was probed overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were cooled to 4°C for 30 seconds and quenched with 1.2 mM unlabeled SAM (NEB) and blotted onto Hybond-XL membrane ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoprecipitation was performed overnight under rotation at 4 using 1/100 T7RNA antibody (Biolabs CB MAB-0296MC) and antiflag (Sigma F1804 and F3165) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pull-down was performed with 100 μl pre-blocked (NETS buffer with 4 mg/ml BSA (NEB) and 2 mg/ml tRNA (SigmaAldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Ligation was performed for 4 h at 16°C using 10,000 units of T4 DNA ligase (NEB) in 1.2 mL of ligation buffer (120 μL of 10× T4 DNA ligase buffer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Nuclei were pelleted at 500 × g at 4°C for 5 minutes and resuspended in 0.5 mL of 1.2x NEBuffer r2.1 (New England Biolabs) containing 3% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Genomics 2023Quote: ... Nuclei were pelleted at 4℃ and washed once with cold 1.4 × NEB buffer 3.1 (NEB Cat#B7203S). Nuclei were then re-suspended in 25μl of 1.4 × NEB buffer 3.1 and treated with 0.1% SDS for 10min at 65℃ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were centrifuged (500xg, 5 min, 4°C) and washed once with 1X NEBuffer 2.1 (NEB, #B7202). For nucleosome depletion ...
-
bioRxiv - Biophysics 2024Quote: ... 10 µl of each sample was mixed with 4 µL native loading dye (1% Orange G (NEB) dissolved in 50% glycerol and 50% EMSA buffer ...