Labshake search
Citations for New England Biolabs :
1 - 50 of 148 citations for IL 13 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... and SNAP-Surface Block at 13 μM (NEB) for 20 min at 25°C (for intracellular labeling ...
-
bioRxiv - Genomics 2024Quote: ... and 13% second strand synthesis enzyme mix (NEB) was added ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 mL ERA reaction (13 T4 DNA ligase buffer [NEB] ...
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 13 μl of 10× NEBuffer3.1 and 100 units of MboI (NEB, R0147M) were added and the chromatin was digested at 37 °C overnight while shaking ...
-
bioRxiv - Genomics 2023Quote: ... Then we added 13 μl of Q5 Ultra II (NEB, 2x mastermix), 1 μl S5 primer ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified for 13 cycles using Q5 High-Fidelity 2X Master Mix (NEB) according to manufacturer's instructions ...
-
MET functions in tumour progression and therapy resistance are repressed by intronic polyadenylationbioRxiv - Molecular Biology 2023Quote: ... Libraries were amplified by 13 cycles of PCR with Phusion polymerase (New England Biolabs). A size selection step was done using Agencourt AMPure XP (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... and succinyl-lysine (PTM Biolabs, Chicago, IL, USA) were used to capture SIRT1-SIRT7 proteins overnight at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 16.4 mL elution was taken into 40 mL ligation reaction (13 Quick ligase buffer [NEB] ...
-
bioRxiv - Genetics 2022Quote: ... or 13 cycles using oligos CT279 and CT297 with Phusion polymerase and HF reaction buffer (NEB). Each reaction was then analyzed by PAGE on a 12% TBE gel ...
-
bioRxiv - Neuroscience 2022Quote: DNA was purified using the Monarch PCR and DNA cleanup kit (New England Biolabs, 13-0041) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Genetics 2019Quote: ... and 2.0 units of the CspCI enzyme ((N)10-11CAA(N)5GTGG(N)12-13) (New England Biolabs). The library preparation was carried out according to the protocol proposed by Osorio-Guarín et al ...
-
bioRxiv - Biochemistry 2023Quote: ... 13 pmol of purified RNA was phosphorylated with y-32P ATP (Hartmann Analytics) by T4 polynucleotide kinase (NEB) for 30 min at 37 °C ...
-
bioRxiv - Systems Biology 2021Quote: ... the beads were used to amplify libraries using 13 cycles of PCR with the Illumina Forward PE1.0 primer and Illumina Reverse indexed primer (New England Biolabs) in the presence of Kapa HiFi HS DNA Polymerase (Kapa Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a PCR with 10-13 cycles was performed using the NEBNext High Fidelity 2X PCR Master Mix (NEB) and Ad1_noMX and Ad2.1–2.12 barcoded primers described in (30) ...
-
bioRxiv - Cell Biology 2024Quote: ... 16.4 mL elution was taken into 40 mL ligation reaction (13 Quick ligase buffer [NEB], 4000U Quick ligase [NEB] ...
-
bioRxiv - Neuroscience 2021Quote: ... and PCR amplified for 13 cycles with Illumina Nextera adapter primers using the NEBNext High Fidelity 2X Master Mix (NEB) with the following PCR program ...
-
bioRxiv - Molecular Biology 2022Quote: ... regions flanking each target site were PCR amplified using locus-specific primers bearing tails complementary to the TruSeq Illumina adapters as described previously.13 25-50ng input genomic DNA is PCR amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs): (98°C ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription (IVT) was performed at 37°C for 13-16h with the HiScribe T7 RNA Polymerase kit (NEB). The remaining DNA was digested by Turbo DNase I (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... Then barcodes from the Native Barcoding Expansion 1-12 & 13-24 from Oxford Nanopore Technologies (ONT) were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA was purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex, Deduped and Fivepercent methods and 10 for Illumina and 13 for NEB). We normalized the data using the DESeq2(40 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pre-amplified PCR products were transferred to 96-well plates and further amplified for an additional 13 cycles using custom Nextera dual-index primers and NEBNext High-Fidelity 2X PCR master mix (New England Biolabs). Individually barcoded libraries were pooled and purified on a single MinElute column (Qiagen) ...
-
bioRxiv - Immunology 2022Quote: ... Then 13 μl PCR heteroduplexes were digested by 2 μl of 1 U/μL T7 Endonuclease I (New England Biolabs) at 37°C for 60 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Barcodes from the Native Barcoding Expansion 1-12 & 13-24 from ONT were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA was purified using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2023Quote: ... and JSW-SS-34:41 (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN TCGTCGGCAGCGTC) to amplify libraries for 11-13 cycles using Phusion High Fidelity PCR Master Mix (NEB) instead of the Illumina-supplied PCR reagents ...
-
bioRxiv - Genomics 2023Quote: ... and amplified using ISOSDB412 IS-Seq Step1 and p7 primers for 13 cycles using Q5 Master Mix (New England Biolabs). The products of this reaction were amplified with IS-Seq Step2 and p7 primers for 9 cycles using Q5 Master Mix and sequenced on a Novaseq 6000 at Novogene (Sacramento ...
-
bioRxiv - Microbiology 2023Quote: ... barcodes from the Native Barcoding Expansion 1-12 & 13-24 from Oxford Nanopore Technologies (ONT) were ligated using the NEBNext Ultra II Ligation Module (NEB). DNA purifications were made using Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed in 25 μL reaction volumes and contained 13 μL Q5® Hot Start High-Fidelity 2× Master Mix (New England Biolabs, US), 0.5 μM of each primer and 0.4 μL of 25 mg/mL BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 10 ng of library DNA was amplified with the p7 primer and the IS-Seq Step1 primer (Table S5) for 13 cycles using Q5 2X Master Mix (New England Biolabs, Ipswich, MA). These reaction products were diluted 1:100 and 10 µL was added to a PCR reaction with the p7 primer and the IS-Seq Step2 primer for 9 cycles using Q5 2X Master Mix ...
-
bioRxiv - Synthetic Biology 2022Quote: In vitro transcription/translation by codon skipping of the short FLAG tag-containing peptides X-Val-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (XV-Flag) where X = 7, 13, 14, or 15 was carried out using the PURExpress® Δ (aa, tRNA) Kit (New England Biolabs, E6840S) based on a previous protocol with slight modifications 16 ...
-
bioRxiv - Genomics 2023Quote: ... Amplification of the libraries was performed for 13 PCR cycles using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, cat. no. M0531L); 6-bp molecular barcodes were also incorporated during this PCR amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... and produced by PCR amplification (10–13 cycles) of tagmented DNA using a NEB Next High-Fidelity 2× PCR Master Mix (New England Biolabs, Ipswich, MA, USA). DNA fragments were then purified using the MinElute PCR Purification Kit and eluted in 10 µL elution buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... pH 8.0) were incubated with pre-washed pan anti-Kbhb beads (PTM Biolabs Inc., Chicago, IL) at 4 °C overnight with gentle shaking ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse α-MBP (NEB, 1:10000); mouse α-Pol II CTD clone 8WG16 (Abcam ...
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Biochemistry 2022Quote: ... MBP (mouse, 1:30,000, New England Biolabs), FLAG (mouse ...
-
bioRxiv - Cell Biology 2019Quote: ... by random priming without denaturation with 4 mg random nonamer oligo (Integrated DNA Technologies, Skoie IL) and 10 units of Klenow (New England Biolabs, Ipswich, MA). Unincorporated dye was removed with Microcon columns (30 kDa MW cutoff ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoprecipitation experiments were performed with 15 μL of Pan anti-glycine lysine antibody conjugated to agarose beads (PTM Biolabs, Chicago, IL, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-PPARα (1:25, Arigo Biolabs ARG55240). Alexa Fluor conjugated secondary antibodies (ThermoFisher Scientific ...
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... anti-MBP mouse 1/80,000 (E8032S, New England Biolabs). Western Blots were quantified using Fiji ...